ID: 988083793

View in Genome Browser
Species Human (GRCh38)
Location 5:26446826-26446848
Sequence TGTCAGGGGCAGGACCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988083793_988083800 -9 Left 988083793 5:26446826-26446848 CCCATCAGGTCCTGCCCCTGACA No data
Right 988083800 5:26446840-26446862 CCCCTGACACATGGGGATTATGG 0: 11
1: 618
2: 1551
3: 2807
4: 4107
988083793_988083806 22 Left 988083793 5:26446826-26446848 CCCATCAGGTCCTGCCCCTGACA No data
Right 988083806 5:26446871-26446893 TTCAAGTTGAGACTTGAGTGGGG No data
988083793_988083804 20 Left 988083793 5:26446826-26446848 CCCATCAGGTCCTGCCCCTGACA No data
Right 988083804 5:26446869-26446891 AATTCAAGTTGAGACTTGAGTGG No data
988083793_988083802 -8 Left 988083793 5:26446826-26446848 CCCATCAGGTCCTGCCCCTGACA No data
Right 988083802 5:26446841-26446863 CCCTGACACATGGGGATTATGGG 0: 15
1: 634
2: 1580
3: 2790
4: 4150
988083793_988083805 21 Left 988083793 5:26446826-26446848 CCCATCAGGTCCTGCCCCTGACA No data
Right 988083805 5:26446870-26446892 ATTCAAGTTGAGACTTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988083793 Original CRISPR TGTCAGGGGCAGGACCTGAT GGG (reversed) Intergenic
No off target data available for this crispr