ID: 988088183

View in Genome Browser
Species Human (GRCh38)
Location 5:26498810-26498832
Sequence CCTTATAAGAAGAGACACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988088181_988088183 -5 Left 988088181 5:26498792-26498814 CCATGATAGTATTGGTGTCCTTA No data
Right 988088183 5:26498810-26498832 CCTTATAAGAAGAGACACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988088183 Original CRISPR CCTTATAAGAAGAGACACAA AGG Intergenic
No off target data available for this crispr