ID: 988094224

View in Genome Browser
Species Human (GRCh38)
Location 5:26582314-26582336
Sequence CATTATATGAAGAGAGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988094222_988094224 12 Left 988094222 5:26582279-26582301 CCATCTTTGGGAAAGAGGTCAAT No data
Right 988094224 5:26582314-26582336 CATTATATGAAGAGAGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988094224 Original CRISPR CATTATATGAAGAGAGAATC TGG Intergenic
No off target data available for this crispr