ID: 988099279

View in Genome Browser
Species Human (GRCh38)
Location 5:26657045-26657067
Sequence GTTGCAGGGCACTGAGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988099273_988099279 2 Left 988099273 5:26657020-26657042 CCACAGCTGAAGCTGAAATGGCT No data
Right 988099279 5:26657045-26657067 GTTGCAGGGCACTGAGCAGTGGG No data
988099271_988099279 10 Left 988099271 5:26657012-26657034 CCTTTTAGCCACAGCTGAAGCTG 0: 14
1: 174
2: 360
3: 740
4: 1219
Right 988099279 5:26657045-26657067 GTTGCAGGGCACTGAGCAGTGGG No data
988099270_988099279 11 Left 988099270 5:26657011-26657033 CCCTTTTAGCCACAGCTGAAGCT 0: 18
1: 170
2: 376
3: 759
4: 1335
Right 988099279 5:26657045-26657067 GTTGCAGGGCACTGAGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988099279 Original CRISPR GTTGCAGGGCACTGAGCAGT GGG Intergenic
No off target data available for this crispr