ID: 988104966

View in Genome Browser
Species Human (GRCh38)
Location 5:26733033-26733055
Sequence GAATTTTTTTTTAAGTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988104966_988104969 -9 Left 988104966 5:26733033-26733055 CCTACCAACTTAAAAAAAAATTC No data
Right 988104969 5:26733047-26733069 AAAAAATTCCCTGGTCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988104966 Original CRISPR GAATTTTTTTTTAAGTTGGT AGG (reversed) Intergenic
No off target data available for this crispr