ID: 988106075

View in Genome Browser
Species Human (GRCh38)
Location 5:26750156-26750178
Sequence AAGGAGAAGAAAAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988106075_988106080 9 Left 988106075 5:26750156-26750178 CCCTCCTCTTTTTTCTTCTCCTT No data
Right 988106080 5:26750188-26750210 ATCTGTATATCTTATTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988106075 Original CRISPR AAGGAGAAGAAAAAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr