ID: 988117748

View in Genome Browser
Species Human (GRCh38)
Location 5:26919460-26919482
Sequence GGGGCCTAAAATAAACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988117746_988117748 -4 Left 988117746 5:26919441-26919463 CCATGGGCTAAAGGGTTCTGGGG 0: 1
1: 12
2: 46
3: 130
4: 341
Right 988117748 5:26919460-26919482 GGGGCCTAAAATAAACTTGAAGG 0: 1
1: 0
2: 3
3: 17
4: 124
988117739_988117748 12 Left 988117739 5:26919425-26919447 CCAGCAAGTCCTGCTACCATGGG 0: 1
1: 0
2: 6
3: 25
4: 148
Right 988117748 5:26919460-26919482 GGGGCCTAAAATAAACTTGAAGG 0: 1
1: 0
2: 3
3: 17
4: 124
988117737_988117748 19 Left 988117737 5:26919418-26919440 CCAAATGCCAGCAAGTCCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 140
Right 988117748 5:26919460-26919482 GGGGCCTAAAATAAACTTGAAGG 0: 1
1: 0
2: 3
3: 17
4: 124
988117743_988117748 3 Left 988117743 5:26919434-26919456 CCTGCTACCATGGGCTAAAGGGT 0: 1
1: 0
2: 7
3: 21
4: 79
Right 988117748 5:26919460-26919482 GGGGCCTAAAATAAACTTGAAGG 0: 1
1: 0
2: 3
3: 17
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988117748 Original CRISPR GGGGCCTAAAATAAACTTGA AGG Intronic
906169130 1:43708936-43708958 TGGGCCTATAATATACTTGAGGG + Intronic
908098894 1:60770516-60770538 GGGGTCTAGAATAAGTTTGATGG + Intergenic
908678613 1:66633846-66633868 GGGAACTAAAATAAACCTGATGG + Intronic
909942791 1:81630569-81630591 GAGGCATAAAAGAAACTCGAAGG - Intronic
912327588 1:108783178-108783200 TGGCCTTAAAATAAACTTTATGG - Intronic
916525865 1:165608745-165608767 TGGGTCTAAAATAAATTTGGTGG + Intergenic
917007600 1:170432471-170432493 GGGGCTTAAAATGAAGATGACGG + Intergenic
918417372 1:184325241-184325263 GGGGACTAAAATGAAAGTGATGG - Intergenic
918854232 1:189729888-189729910 GAGGCCCAGAATAAATTTGAAGG - Intergenic
920028108 1:203016254-203016276 GGGGACTAATGTAAACTTCAGGG + Intronic
921392702 1:214632894-214632916 GGGGTCTAAAACAATCTTTAAGG - Intronic
924206752 1:241719803-241719825 GGAACTTAAAATAAATTTGAAGG - Intronic
1063207132 10:3843681-3843703 GGTCCCTACAATAAACTTGACGG + Intergenic
1067324427 10:45253521-45253543 GGGGCCCTAAGTGAACTTGAGGG + Intergenic
1071161287 10:82748481-82748503 TAGGCTTAAAAAAAACTTGAAGG + Intronic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1079713992 11:23721323-23721345 GTGGCCTAAGATAGACTTGTTGG - Intergenic
1084571144 11:69960626-69960648 GGGGGCTATCATAAACTTGGTGG - Intergenic
1085488992 11:76896356-76896378 GGGGCATAAAAAAAACTAGTGGG + Intronic
1086335334 11:85795211-85795233 GGGGCTGAAAATAAACTTAGCGG - Intronic
1086838305 11:91653352-91653374 GGGGCCCTAAATGAACCTGAGGG - Intergenic
1088546765 11:110966954-110966976 GTGGCCTAAGATAATTTTGATGG - Intergenic
1088951016 11:114569930-114569952 TGGGCCTATAATAAACTTTGAGG - Intergenic
1090969539 11:131628546-131628568 CAGGCCCAAAATAAAGTTGAAGG - Intronic
1097552411 12:61090928-61090950 GGGGCTCTAAATAAACTTGAAGG - Intergenic
1098033535 12:66279258-66279280 TGGGCTTAAAATAATGTTGAAGG - Intergenic
1098232089 12:68381727-68381749 GGGGCCTAAAAATAATTTGGGGG + Intergenic
1107734171 13:43378700-43378722 GGGTCCTAAAATAAACTTCACGG + Intronic
1108114482 13:47111689-47111711 TGGGCCTGTAATAAACTTTAAGG + Intergenic
1108879021 13:55086623-55086645 GGGGTCCTAAATAAACTTGAAGG + Intergenic
1108879128 13:55087435-55087457 GGGGTCCTAAATAAACTTGAAGG - Intergenic
1109031783 13:57199699-57199721 GGTGCCCTAAATTAACTTGAAGG - Intergenic
1109045816 13:57409486-57409508 GGGGGCCTAAATAAACTTGGAGG + Intergenic
1110753204 13:79139983-79140005 GGGGCTTAAATTAGACTTCAGGG + Intergenic
1111790449 13:92848546-92848568 GGGGCTTAAAATCAAGTAGATGG + Intronic
1111973955 13:94946182-94946204 GGGGACAAGAATAAACTTTAGGG - Intergenic
1115133851 14:30086006-30086028 GGGGCCCTAAGTGAACTTGAAGG + Intronic
1116669511 14:47822413-47822435 GGGTTCCTAAATAAACTTGAAGG - Intergenic
1119262130 14:73244271-73244293 GGGGCCTAAAAGAAAATAAAGGG - Intronic
1120741410 14:88112889-88112911 GGGGCCTAGAATAAAAGGGAAGG + Intergenic
1120770944 14:88379975-88379997 GGGGCCCTAAGTGAACTTGAGGG - Intergenic
1122166844 14:99832012-99832034 GGGGCACAAAAGAAACTTTAGGG - Intronic
1123175451 14:106412868-106412890 GGAGCCTGAAATAAATTTTATGG - Intergenic
1128281170 15:66395973-66395995 GGGGCCTAGAATAAAATAAATGG + Intronic
1133787319 16:8983654-8983676 GGGGCCTAAGACAACCTTGTAGG + Intergenic
1136120402 16:28129313-28129335 AGGGCATCAAGTAAACTTGAGGG + Intronic
1140582231 16:76245092-76245114 GAGTCCTGAACTAAACTTGAGGG - Intergenic
1149397010 17:56255234-56255256 GGGCCCTCAAATATACTGGAGGG + Intronic
1150531727 17:65990673-65990695 GGGACCTTAAGTGAACTTGAAGG + Intronic
1150969808 17:70015077-70015099 GAGGCCCAAAATAAACAGGAAGG + Intergenic
1150992097 17:70271548-70271570 GGGGAATAAAAGAAACCTGATGG - Intergenic
1151276867 17:73041429-73041451 TGGGCCTAAAAGAGACCTGATGG + Intronic
1152825275 17:82460764-82460786 CGAGACTGAAATAAACTTGAAGG + Intronic
1153183397 18:2460537-2460559 GGGCCCCTAAATAAAATTGAAGG - Intergenic
1156973405 18:43185628-43185650 GTGGACTAAAATAAGTTTGAAGG - Intergenic
1158578359 18:58659694-58659716 GGGGCCTAAATTGTACCTGAAGG - Intergenic
1158654463 18:59317860-59317882 AGGGCCTAAAATAACATAGAGGG - Intronic
1159731474 18:72033398-72033420 GGGGATCAAAATAAACTTGAAGG - Intergenic
1162273777 19:9637190-9637212 GGGGCCTAAGATATCCCTGAGGG + Intronic
1166157945 19:40929076-40929098 TGGGCCTGTAATAAACTTTAAGG + Intergenic
925754607 2:7121456-7121478 GGGGCTTAAAACCAACATGACGG - Intergenic
927560284 2:24066729-24066751 GGAACCTAAAATCAATTTGAAGG - Intergenic
927562440 2:24083603-24083625 GGGGCACAAAAGAAACGTGATGG - Intronic
927848695 2:26485555-26485577 TGGGCTTAAAGTAAACCTGAAGG - Intronic
929240764 2:39650907-39650929 GGGGCTTTAAATAAAGATGACGG - Intergenic
931582925 2:63796737-63796759 GGGATCCTAAATAAACTTGAAGG + Intronic
932756527 2:74413700-74413722 GGAGCCTAAGATAAAATTTAAGG + Intergenic
933935225 2:87198513-87198535 GGGGCCTCAAAAAATCCTGAGGG + Intergenic
935093677 2:99922815-99922837 TGGGGCTAAAATAAACCTCACGG + Intronic
936357924 2:111767386-111767408 GGGGCCTCAAAAAATCCTGAGGG - Intronic
943945583 2:194058367-194058389 AGGGCCTAAATAAAACTGGAGGG + Intergenic
944383926 2:199143005-199143027 GAGGCAGAAAATAAACATGATGG - Intergenic
945119799 2:206444982-206445004 GGGGGGTAGAATGAACTTGAGGG - Intronic
1171350749 20:24501445-24501467 AGGGCCTGAAATAAGCTTGAAGG - Intronic
1177931618 21:27292299-27292321 GGGGTATAAAAGAAACTTCAGGG - Intergenic
1178175577 21:30094182-30094204 GAGGCATAAAACAAACTAGAAGG - Intergenic
1183194054 22:36341068-36341090 GGGGCCTAAAAGAAAGCAGAGGG + Intronic
952209557 3:31215728-31215750 GGGTCATAAAATAAACTTTGTGG + Intergenic
953217149 3:40930342-40930364 GGGGCCCTAAGTGAACTTGAGGG + Intergenic
954724598 3:52596935-52596957 GGGGTCCTAAATAAACTTGAAGG - Intronic
957485615 3:80858614-80858636 GGGGCTCTAAATAAACTTGAAGG + Intergenic
959046126 3:101475691-101475713 GGAACTTAAAATAAAATTGAAGG + Intronic
960207397 3:114918970-114918992 GGGGTCCTAAATAAACTTTAAGG - Intronic
964253611 3:154749642-154749664 GGGGCCCTAAATAAACTTAAAGG + Intergenic
970088366 4:12373646-12373668 TGGGCCTCAAATATACTTAAGGG + Intergenic
970441752 4:16086052-16086074 GGGGCCCCAAATAACCTTAAAGG + Intergenic
973227370 4:47801792-47801814 GGGACTTTAAATGAACTTGAGGG + Intronic
976865821 4:89725121-89725143 GGTGCTGAAAATAAACTTGATGG - Exonic
977527914 4:98166691-98166713 GGGACTTTAAATAAACGTGAAGG - Intergenic
977999810 4:103543519-103543541 GGAGCTTAAAATAAAATTGATGG + Intergenic
981996069 4:150977006-150977028 GGGCCTCTAAATAAACTTGAAGG + Intronic
987730129 5:21759466-21759488 GGTGGCTAAAATGATCTTGATGG + Intronic
988117748 5:26919460-26919482 GGGGCCTAAAATAAACTTGAAGG + Intronic
989512809 5:42308145-42308167 GGGGCACAAAATAAGCCTGATGG - Intergenic
990579139 5:57151304-57151326 GGGGCCCTAAATAAACTTGAGGG - Intergenic
990809345 5:59704904-59704926 GAGAACTAAAATAAACCTGATGG - Intronic
990923766 5:60995958-60995980 TGGGCCTAAAAGAAACATCAGGG - Intronic
993588264 5:89759964-89759986 GAGGGCTAAAATAATCTTCAAGG - Intergenic
999460707 5:151755715-151755737 AGGGGCAAAAATAAATTTGAGGG + Intronic
1000810492 5:165855554-165855576 GAGGCTTAAAATCATCTTGAAGG + Intergenic
1003998208 6:11565373-11565395 GGGGTTTAATATAAAATTGATGG + Intronic
1004905633 6:20234806-20234828 TGGGCCTAATATAAGCATGAGGG - Intergenic
1005546103 6:26873555-26873577 GGGGTTTAAAATAAATTTCAGGG + Intergenic
1006605273 6:35251735-35251757 AGGACCTAAATTAAACTTGGTGG - Exonic
1008238812 6:49083890-49083912 GGGGTTCTAAATAAACTTGAAGG + Intergenic
1008383735 6:50862951-50862973 GGGGCCTTGAATGAACTTGAAGG + Intergenic
1010343145 6:74781009-74781031 GGAGCTCTAAATAAACTTGAAGG + Intergenic
1010443699 6:75927867-75927889 GGGGCATAACATGGACTTGAGGG - Intronic
1013182936 6:107733188-107733210 GGGGCTTAAAATAACATTTAGGG - Intronic
1015575787 6:134669547-134669569 TGGGCCTAACATAATCTTGCTGG + Intergenic
1016667741 6:146662205-146662227 GGGGCAAAAAATATAGTTGAAGG - Intronic
1020624149 7:10557673-10557695 CGGGCCCTAAGTAAACTTGAAGG + Intergenic
1023459351 7:40378153-40378175 GGGGCCTAAAAGAATATTTAAGG - Intronic
1024579721 7:50792596-50792618 GGGGCCTAACACCAAGTTGAGGG - Intronic
1024956435 7:54926278-54926300 GGGGCCCTGAGTAAACTTGAGGG + Intergenic
1033499818 7:141936595-141936617 GGGGCCCTAAATAAACTTGAAGG + Intronic
1035346845 7:158205970-158205992 GGGGTCCTAAATAAACTTGAAGG + Intronic
1036728127 8:11238451-11238473 CAGGCCGAAAATAAAGTTGAAGG + Intergenic
1036897669 8:12648947-12648969 GGGGCTTAAAACAAAGATGACGG + Intergenic
1038278027 8:26138323-26138345 GGAGCCTAAAAGAAGGTTGAAGG + Intergenic
1039640872 8:39219361-39219383 GGGGCCCTAAGTGAACTTGAGGG - Intronic
1041615944 8:59907050-59907072 AGGGTCCTAAATAAACTTGAAGG + Intergenic
1042841555 8:73129471-73129493 GGGGCATAAGATAAGCATGATGG + Intergenic
1044861038 8:96524222-96524244 TGAACCTAAAATAAAATTGATGG + Intronic
1046993408 8:120486992-120487014 AGCCCCTAAAATAAACTTAAGGG + Intronic
1047470070 8:125162027-125162049 GGGGGCTAAAATAAACCTCAGGG - Intronic
1048172657 8:132122565-132122587 TGGGCTTAAAATAAGCTTCAAGG - Exonic
1049314239 8:141951866-141951888 GGTGGCTACAATAAACATGAAGG + Intergenic
1051720306 9:20029956-20029978 TGGGCCTGTACTAAACTTGAGGG + Intergenic
1052281816 9:26741752-26741774 GGGGCCTAGAAGCAATTTGAAGG - Intergenic
1054831905 9:69634428-69634450 GAGGTCCTAAATAAACTTGAAGG + Intronic
1057962144 9:99467119-99467141 GGGGCCCAAATTATACTTGTTGG + Intergenic
1188780091 X:34271647-34271669 AGGGCATATAATAAACTGGAAGG - Intergenic
1189858040 X:45243336-45243358 GGGGCTTAAAATCTACATGATGG - Intergenic
1189962241 X:46334759-46334781 GGGGACTCACATAAACTTAAAGG + Intergenic
1190752082 X:53371205-53371227 GGGGCAAAAAGTAGACTTGATGG + Intergenic
1192088072 X:68121573-68121595 GGATCCCTAAATAAACTTGAAGG + Intronic
1193241118 X:79170718-79170740 GGGCCTTAAAATAAACAAGAGGG + Intergenic
1193394616 X:80968917-80968939 GGGGCCAAAAGTTAACTGGATGG + Intergenic
1193648522 X:84099622-84099644 GGGGCTTACAAAAAAGTTGAGGG - Intronic
1194223550 X:91226968-91226990 GGGGCTCTAAAGAAACTTGAAGG + Intergenic
1196215771 X:113050250-113050272 GGGGTCCTAAATAAACCTGAAGG + Intergenic
1198939003 X:141932061-141932083 GGGTCCCTAAATAAACTTGAAGG - Intergenic
1199043571 X:143142052-143142074 AGGTCCCAAGATAAACTTGAGGG + Intergenic
1200560016 Y:4690350-4690372 GGGGCTCTAAAGAAACTTGAAGG + Intergenic