ID: 988120413

View in Genome Browser
Species Human (GRCh38)
Location 5:26954174-26954196
Sequence CTGGATTACCAGGTCTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988120409_988120413 27 Left 988120409 5:26954124-26954146 CCATGTATCTCAATGTAATTTGG 0: 1
1: 0
2: 2
3: 16
4: 243
Right 988120413 5:26954174-26954196 CTGGATTACCAGGTCTCTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988120413 Original CRISPR CTGGATTACCAGGTCTCTGT TGG Intronic
900584691 1:3427178-3427200 CTGGGATACCAGGGCTCCGTAGG + Intronic
903425976 1:23254541-23254563 CTGTACCACCAGCTCTCTGTCGG - Intergenic
905012453 1:34756632-34756654 CTGGAATACCAGGTTACTCTAGG + Intronic
905847411 1:41243855-41243877 CTGTTTTGCCAGCTCTCTGTTGG + Intergenic
906257379 1:44360570-44360592 CAGGATTACCAGGTGTGGGTCGG - Intergenic
908427557 1:64022479-64022501 CTGTACTGCCAGGTCTCTGAGGG + Intronic
910052442 1:82991439-82991461 CTGGATTCCAAAGTCTCTATGGG + Intergenic
910723121 1:90309511-90309533 GTGGTTTACCAGGTTTCTCTAGG + Intergenic
915511741 1:156390425-156390447 CTGGATTTCCAGGGATCTCTGGG + Intergenic
918188252 1:182146599-182146621 CAGTATTACCAGGTGTCTGTGGG - Intergenic
919698065 1:200599704-200599726 CTGGATCACAAGCTCTCTGAGGG + Intronic
921132351 1:212230487-212230509 CTGGATGCCCAGGACTCTGGAGG + Intergenic
922061709 1:222098871-222098893 CTGTATTACATGGTCTCTGTAGG - Intergenic
923232403 1:231999513-231999535 CTGGCTAACCAGGTGTCTCTGGG - Intronic
1064478150 10:15713783-15713805 CTGGATGACAAGGTTTTTGTTGG - Intronic
1065764556 10:29015661-29015683 CTGTAATGCCAGCTCTCTGTAGG - Intergenic
1065928127 10:30454216-30454238 CAGGATTACCAGGTCAGTCTTGG + Intronic
1066630701 10:37456754-37456776 CTGGTCAACCAGGTCTCTCTGGG + Intergenic
1069214910 10:65807362-65807384 CTGGATGATCAAGTCTCTGGAGG + Intergenic
1073858126 10:107701435-107701457 CCAGATCACCAGGTCTCTCTTGG + Intergenic
1074134861 10:110617490-110617512 CAGTATTACCAGGCCTATGTGGG + Intergenic
1074199752 10:111224353-111224375 CTGGCTTCCCAGGTCTCCATGGG - Intergenic
1077108839 11:853335-853357 CTGGCTTCCAAGGTCTCTTTGGG + Intronic
1078993873 11:16676932-16676954 CTAGATTACCAGGAATATGTGGG + Intronic
1085514022 11:77102081-77102103 CTGGTTTATCAGGGCTCTGTGGG - Intronic
1089428259 11:118399348-118399370 CTGCCTTACCAGGCCTCTGGAGG + Intronic
1091024732 11:132131975-132131997 CTCTATTAACTGGTCTCTGTAGG - Intronic
1093210649 12:16304282-16304304 CTGGATTACCAGCAGTTTGTAGG - Intergenic
1096805468 12:54138481-54138503 CTTGATCACCAGGTATCTCTGGG - Intergenic
1097448778 12:59710511-59710533 CTAGATTATCAGCCCTCTGTAGG - Intronic
1098002350 12:65958744-65958766 CTAGATTACCAAGTATTTGTAGG + Intronic
1102057636 12:109908468-109908490 CTGCATGGCCAGGCCTCTGTTGG + Intronic
1102584227 12:113912020-113912042 CTGCATTTCCATGTTTCTGTGGG - Intronic
1102925848 12:116825699-116825721 CTGGAAAACTAGGTCTCTGGGGG - Intronic
1107171457 13:37347143-37347165 CTGGATTCCCAGTTCTTTGAGGG + Intergenic
1109148143 13:58808574-58808596 TTGGATAACCAGGTCCCTGAAGG - Intergenic
1112185964 13:97127978-97128000 CTAGATTTTCAGGTTTCTGTAGG + Intergenic
1116118080 14:40682692-40682714 CTGGATTGCCAGGTTCCTGGTGG + Intergenic
1116269015 14:42736530-42736552 CTGAACTATCACGTCTCTGTTGG + Intergenic
1118105983 14:62660128-62660150 CAGAAGTACCAGGTCTCTGAGGG + Intergenic
1124352286 15:28965364-28965386 CTTGATTACTATATCTCTGTAGG + Intronic
1125720075 15:41841161-41841183 GGGGATGCCCAGGTCTCTGTGGG + Intronic
1126057555 15:44745012-44745034 CTAGATTACCAGGAATATGTGGG - Intronic
1129187967 15:73922249-73922271 CTAGATTTGCAGGTCTCTGCTGG + Intergenic
1130119982 15:81039513-81039535 CTGGAAAGCCAGGGCTCTGTAGG - Intronic
1130538379 15:84802979-84803001 CTGGCTCATCATGTCTCTGTGGG + Exonic
1130765044 15:86861290-86861312 CTGGATTTCAAGCTCTCTGAGGG - Intronic
1131766212 15:95678269-95678291 CTGGGTTACCAGTACTCTCTTGG + Intergenic
1133502372 16:6378319-6378341 CTGGGTCACCATCTCTCTGTTGG - Intronic
1139542116 16:67625890-67625912 CTGGAAAACCAGGTAGCTGTTGG - Intronic
1143567676 17:7734373-7734395 TTGGGTTAGGAGGTCTCTGTCGG + Intronic
1146307113 17:31738786-31738808 CTTTACTTCCAGGTCTCTGTGGG + Intergenic
1146447089 17:32940864-32940886 CTGGATTGACCAGTCTCTGTCGG + Exonic
1148245661 17:46028466-46028488 CAGGATTAACAGCTCTCTCTGGG + Intergenic
1148964569 17:51423832-51423854 CTGGATCACCAGCTTTATGTTGG - Intergenic
1149134174 17:53344952-53344974 CTGGATGACCCAGTCTCTGTGGG - Intergenic
1150487917 17:65556742-65556764 CTGGATTTCCCTTTCTCTGTAGG - Intronic
1150937165 17:69649194-69649216 CTGCATTACTAGGTCTTTCTTGG - Intergenic
1150994818 17:70305250-70305272 CTGGTTTGCCAGGACTCAGTGGG - Intergenic
1151352512 17:73540060-73540082 CTGCATGACCCCGTCTCTGTTGG - Intronic
1153299617 18:3581344-3581366 CTGGCTTATCATGTCTCTGTGGG + Intronic
1156608930 18:38703215-38703237 CTTGGTTAGCATGTCTCTGTGGG - Intergenic
1157494617 18:48147417-48147439 CTGGATTTCCAAATCTCTGGTGG + Intronic
1160733811 19:652817-652839 CTGCATTACCTGGTCTCTTCCGG + Exonic
1166130712 19:40744099-40744121 CTGCAGGACGAGGTCTCTGTTGG + Exonic
1166351247 19:42199433-42199455 CTGGATCAGGAGGCCTCTGTCGG + Exonic
927143204 2:20143551-20143573 CAGGATTTTCAGGTCTCTATGGG - Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
932010963 2:67977023-67977045 CTGGCTTACCAGGTCTGGGGTGG - Intergenic
935466143 2:103400295-103400317 CTGAACTACAAGGACTCTGTTGG - Intergenic
938090913 2:128434244-128434266 CTGGATGTCCAGGTGTCTCTGGG + Intergenic
940408130 2:153328912-153328934 CTTGAAAACCAGGGCTCTGTTGG + Intergenic
1170772298 20:19343598-19343620 ATGGAGTACAGGGTCTCTGTGGG + Intronic
1174741922 20:53022967-53022989 CTGGTTTTCCAGGACTCTGCTGG + Intronic
1176189901 20:63803569-63803591 CGGGCTGCCCAGGTCTCTGTCGG + Intronic
1179843607 21:44094132-44094154 CTGCATTGCCGGTTCTCTGTTGG + Exonic
1184316407 22:43695639-43695661 CTGGATTCCTTAGTCTCTGTCGG - Intronic
952891969 3:38049207-38049229 CTGGTTTCTCAGGTCTCTGCTGG + Intronic
953693325 3:45138382-45138404 CTGTATAACCAGGTCTCTAGTGG - Intronic
953980739 3:47411744-47411766 CTGGAAAACCAGGTCTGTCTTGG + Intronic
955091213 3:55752455-55752477 CTGGTTTACCAGCGCTCTATTGG + Intronic
956559416 3:70557950-70557972 CTGGATTACCAGATCTTTCTGGG + Intergenic
960022535 3:112971394-112971416 CTGTATTTCCAAGTATCTGTAGG + Intronic
961234370 3:125351813-125351835 TTTGATTAGCATGTCTCTGTTGG - Intronic
962373742 3:134842416-134842438 CTGGATGAACAGGGCTCTGATGG - Intronic
966567769 3:181402466-181402488 CTGGCTAAACAGGACTCTGTGGG + Intergenic
966983372 3:185157836-185157858 CTGGCTCAGCAGATCTCTGTTGG - Intergenic
968248709 3:197184196-197184218 CTGGACTACCAAGACCCTGTGGG + Intronic
968918067 4:3505982-3506004 CTGGGTTTCCAGGTATCTCTAGG - Intergenic
969147356 4:5135863-5135885 CTGGATCACAAGGTCACTGCTGG + Intronic
971676804 4:29641708-29641730 CTGTAATCCCAGCTCTCTGTGGG - Intergenic
972249467 4:37284531-37284553 CTGGAGATCCAGGGCTCTGTGGG - Intronic
972739622 4:41877875-41877897 CTGGAGCACCAAGTGTCTGTAGG + Intergenic
980640865 4:135577322-135577344 CTGGATCATGAGGTTTCTGTCGG - Intergenic
987904560 5:24059310-24059332 CTGGATTACAATTTTTCTGTTGG - Intronic
988120413 5:26954174-26954196 CTGGATTACCAGGTCTCTGTTGG + Intronic
991536714 5:67676986-67677008 CTGGACTTCCAGGCCTATGTGGG + Intergenic
992390967 5:76330677-76330699 CTTGATTACCTGGTTTTTGTTGG + Intronic
997897444 5:137732327-137732349 CTAGATTTCCAGGTCTCTCCTGG - Intronic
998164129 5:139832659-139832681 CTGGAATACCAGAGTTCTGTAGG + Intronic
998371194 5:141662396-141662418 CTTGATTCTCAGGTCTCTGCTGG + Intronic
998648029 5:144085595-144085617 CTGGAATGCAAAGTCTCTGTGGG + Intergenic
999078961 5:148825864-148825886 CTGGGTTACCGGGTGTATGTTGG + Exonic
1001860813 5:175053195-175053217 CTGCAGTACCAGGACTGTGTAGG - Intergenic
1002178477 5:177416616-177416638 CTGCATTGCCACATCTCTGTAGG + Intronic
1003078698 6:3003940-3003962 CTGGATTCCCGGGGCTCTCTTGG - Intronic
1003084641 6:3051782-3051804 CTGGATTCCCGGGGCTCTCTTGG + Intergenic
1003863038 6:10339227-10339249 CTTGATTCCTAGTTCTCTGTGGG + Intergenic
1005375530 6:25178686-25178708 CTGGATTAGAACGTCTCTGGAGG - Intergenic
1006841032 6:37027978-37028000 CTGGGCTACCAGGTGACTGTTGG + Exonic
1006900436 6:37497044-37497066 CTAGAGTACCAGGTCTATGGTGG - Intronic
1007274413 6:40662852-40662874 CAGGATCTCCAGGTGTCTGTGGG + Intergenic
1007864316 6:44951615-44951637 CTGGATTTCCTGGGCTCTCTGGG - Intronic
1008632954 6:53381612-53381634 CTGGAATGCCAGGCCTCTGAGGG + Intergenic
1009570151 6:65374521-65374543 CTGGAGTTCCAGGTATCAGTGGG - Intronic
1016698270 6:147023721-147023743 CTGGATTATCAGCTCTTTGGAGG - Intergenic
1016751773 6:147638006-147638028 ATGTATTAGCAGGTCTCTGTAGG - Intronic
1021867343 7:24971286-24971308 CTGGATAACCAGGGTTCTTTGGG + Intronic
1031961461 7:127993853-127993875 CTTGATGACCAGGCCTCTGTCGG - Intronic
1031980030 7:128118877-128118899 CTGGATACCCAGGCCTCTGCTGG + Intergenic
1037292011 8:17360980-17361002 GTGGATTTCCAGGTCTCTCTTGG - Intronic
1037579486 8:20236186-20236208 CTGGATCACCATGACCCTGTGGG + Intergenic
1037819013 8:22126893-22126915 CTGGATCACGAGGGCTCTCTGGG - Intronic
1040349335 8:46548206-46548228 CTGGAATACCAACACTCTGTTGG + Intergenic
1047462515 8:125080653-125080675 ATGGAATACCAGGTCAATGTCGG - Intronic
1047847434 8:128823001-128823023 CTGGTTTACCTGGTCTCAGGTGG - Intergenic
1049273531 8:141708401-141708423 GTGGACCACCCGGTCTCTGTTGG + Intergenic
1052715192 9:32107647-32107669 CTGGATTACCAGCACTGTGATGG + Intergenic
1055402016 9:75934101-75934123 CTAGCATACAAGGTCTCTGTCGG - Intronic
1055870666 9:80875532-80875554 GTGGATTACCTGCTATCTGTTGG + Intergenic
1058547891 9:106080659-106080681 CTGGAATACCAGCTCTTTGGGGG + Intergenic
1059664913 9:116437509-116437531 GTGGATTGCCTGGCCTCTGTGGG + Intronic
1060827861 9:126696661-126696683 GGGGATGACAAGGTCTCTGTGGG - Exonic
1061254949 9:129449628-129449650 CTGGATTATCAGGTCCCAGGAGG + Intergenic
1061908022 9:133708684-133708706 CTGGAGTCCCATGTCCCTGTGGG - Intronic
1185781545 X:2851700-2851722 CTGGATTAAGTGGTGTCTGTTGG + Intronic
1185803926 X:3039717-3039739 CTGGATTAAGTGGTGTCTGTTGG + Intergenic
1187680146 X:21759650-21759672 CTGCATAACCAGGGCTCTGTTGG + Intergenic
1190443637 X:50501151-50501173 CTGGAGTACAAGGTGTATGTGGG + Intergenic
1192054800 X:67762096-67762118 CTGCATTGCCAGTTCTCTGATGG - Intergenic
1194797801 X:98234711-98234733 CTGGTTTACTAGATCTCGGTTGG + Intergenic
1196723750 X:118878015-118878037 CAGGATGACCACGTCTCTGTGGG + Intergenic
1197426445 X:126302866-126302888 TTAGATTACCAGGACTCTATTGG - Intergenic
1201276795 Y:12306221-12306243 CTGGATTAAGTGGTGTCTGTTGG - Intergenic
1201300151 Y:12498252-12498274 CTAGATCAGCAGGTCTGTGTGGG + Intergenic