ID: 988128391

View in Genome Browser
Species Human (GRCh38)
Location 5:27073080-27073102
Sequence TGTTAGCTAGAGACCTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988128391_988128400 20 Left 988128391 5:27073080-27073102 CCCACCAAGGTCTCTAGCTAACA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 988128400 5:27073123-27073145 GACAGCACTGCAAGAGGGAGAGG 0: 1
1: 0
2: 2
3: 30
4: 341
988128391_988128398 14 Left 988128391 5:27073080-27073102 CCCACCAAGGTCTCTAGCTAACA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 988128398 5:27073117-27073139 CCATAGGACAGCACTGCAAGAGG 0: 1
1: 0
2: 0
3: 10
4: 117
988128391_988128401 24 Left 988128391 5:27073080-27073102 CCCACCAAGGTCTCTAGCTAACA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 988128401 5:27073127-27073149 GCACTGCAAGAGGGAGAGGCAGG 0: 1
1: 0
2: 8
3: 155
4: 2514
988128391_988128394 -2 Left 988128391 5:27073080-27073102 CCCACCAAGGTCTCTAGCTAACA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 988128394 5:27073101-27073123 CAGAGATCTGAATTCCCCATAGG 0: 1
1: 6
2: 6
3: 33
4: 165
988128391_988128399 15 Left 988128391 5:27073080-27073102 CCCACCAAGGTCTCTAGCTAACA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 988128399 5:27073118-27073140 CATAGGACAGCACTGCAAGAGGG 0: 1
1: 1
2: 0
3: 17
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988128391 Original CRISPR TGTTAGCTAGAGACCTTGGT GGG (reversed) Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
908156203 1:61356188-61356210 TGTTAGCCAGACACTGTGGTAGG + Intronic
911060223 1:93741028-93741050 TCTGAGCTAGAGTCCTTGCTCGG + Intronic
914414705 1:147469087-147469109 GGGTAGCTGGAGACCCTGGTTGG + Intergenic
916837027 1:168556087-168556109 TTTTATCTGGAGACCCTGGTTGG + Intergenic
917714643 1:177722015-177722037 GGGTAGCCAGAGACCCTGGTTGG - Intergenic
917997928 1:180460484-180460506 AGGTAGCTGGAGACCCTGGTTGG - Intronic
920416438 1:205801796-205801818 TGTTAACCAAAGACATTGGTAGG - Intronic
924089488 1:240487618-240487640 TGGTAACTAGAGACCTTCCTGGG - Intergenic
1063688333 10:8259589-8259611 TGTAAGATAGGGACCTTGTTTGG + Intergenic
1066661905 10:37745121-37745143 TGTTAGCTACACACCCTGGTGGG - Intergenic
1070923634 10:80204611-80204633 TGTTACCTAGAGACTTTGGAGGG - Intronic
1073021078 10:100444445-100444467 TTTTAGGTAGAGACCATGGCAGG - Intergenic
1074047964 10:109856544-109856566 TCCTAGCTGGTGACCTTGGTTGG - Intergenic
1074128166 10:110546901-110546923 TGTGAGCTAGAGCTGTTGGTTGG + Intergenic
1081847438 11:46251146-46251168 TCTTAACTAGAGTGCTTGGTGGG + Intergenic
1083008103 11:59367819-59367841 TGTCACCTGGAGAGCTTGGTGGG - Intergenic
1085200468 11:74698873-74698895 TTCTGGCCAGAGACCTTGGTGGG - Intronic
1086801583 11:91183487-91183509 AGGTAGCCAGAGACCCTGGTTGG + Intergenic
1089058492 11:115607095-115607117 TCTGAGCTAGAGAACTTGGCAGG + Intergenic
1089313028 11:117572577-117572599 TGTAAGCTAGAACCCATGGTGGG + Intronic
1093156593 12:15693348-15693370 TGTGAACTAGAGAACTCGGTTGG - Intronic
1093161978 12:15757997-15758019 TGTCAGCTTGAGACCTTAGCTGG + Intronic
1098054351 12:66488519-66488541 TGTTAACTTGAGATCTTGCTAGG - Intronic
1098433564 12:70446391-70446413 TGTTAGCTTGTGATCTTGATTGG - Intergenic
1100401784 12:94237070-94237092 TGGTATCTACAAACCTTGGTTGG + Intronic
1100411264 12:94322088-94322110 AGGTGGCTAGAGACCTCGGTTGG + Intronic
1108155516 13:47580421-47580443 TGGTGGCTATATACCTTGGTAGG - Intergenic
1108338241 13:49468985-49469007 TGTTTGGTAGAGAGCTTGTTTGG - Intronic
1108569079 13:51731479-51731501 TGTTAGTTAGTGACCTTCCTAGG - Intronic
1112351627 13:98639738-98639760 TGTTAGCTAGATGCAGTGGTGGG + Intergenic
1115967836 14:38912035-38912057 GTATAGCTAGAGACCCTGGTTGG - Intergenic
1116082984 14:40200100-40200122 TGTTAACTGGAGACTTGGGTGGG + Intergenic
1117829314 14:59733943-59733965 TGGTGGCTGGAGACCCTGGTTGG - Intronic
1120283147 14:82464192-82464214 GGGTAGCTAGAGACCCTTGTTGG - Intergenic
1128380701 15:67109897-67109919 TGTTATCTGGAGACCCGGGTGGG - Intronic
1128553808 15:68616455-68616477 GGGCAGCAAGAGACCTTGGTGGG - Intronic
1130620162 15:85453795-85453817 TGTTGGCTGGAGAGCTTGGGTGG + Intronic
1135586152 16:23672652-23672674 TGCTGGCTATAAACCTTGGTTGG + Exonic
1145127156 17:20311078-20311100 TGTTAGATTTAGACCTTAGTGGG + Intronic
1147255062 17:39176453-39176475 TGTTACCTAGAGATCTGGGGTGG + Intronic
1153785259 18:8528753-8528775 TGTCAGCTGGAGAGCTTAGTTGG - Intergenic
1155091322 18:22514654-22514676 TGGTGGCTGGAGACCCTGGTTGG + Intergenic
1158750544 18:60254209-60254231 TGTTAGTTAGAAGTCTTGGTTGG - Intergenic
928205681 2:29281615-29281637 ACTTGGCTAGAGATCTTGGTTGG + Intronic
929147651 2:38720747-38720769 TGTTGGCTGGAGGCCTTGCTGGG + Intronic
931396610 2:61893254-61893276 TGTTAACTAGAAACCTTTCTAGG - Intronic
933085855 2:78053312-78053334 GGTTGGCTAGAGGCCCTGGTTGG + Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
934810388 2:97272153-97272175 GGGTAGCTAGAGGCCCTGGTTGG - Intergenic
934827304 2:97435786-97435808 GGGTAGCTAGAGGCCCTGGTTGG + Intergenic
939618032 2:144382336-144382358 TGTTTTCTAGAGACCATTGTGGG + Intergenic
940611279 2:155994864-155994886 CATTAGCTAGAGATCCTGGTTGG + Intergenic
941344376 2:164348885-164348907 GGCTAGCTGGAGACCCTGGTTGG + Intergenic
944363739 2:198892018-198892040 AGGTGGCTAGAGACCCTGGTTGG - Intergenic
944746763 2:202664997-202665019 TTTTATCTGGAGACTTTGGTGGG + Intronic
948320027 2:237061633-237061655 TGTTTGCTTCAGACCTTGGCAGG - Intergenic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1174501662 20:50989431-50989453 TGTCAGCAAGAGACCCTGGAAGG + Intergenic
1174738996 20:52993923-52993945 TGTGAGCTGGAAACCTTGCTGGG + Intronic
1184275706 22:43408522-43408544 TGGCAGGTAGAGACCTTGTTGGG + Intergenic
951469770 3:23044001-23044023 GGGTGGCTGGAGACCTTGGTTGG - Intergenic
952016161 3:28959324-28959346 TGATAGCTGGAGACATTGGGAGG + Intergenic
959897491 3:111620841-111620863 TGTTATTTAGGGACCTTGTTGGG - Intronic
960841447 3:121963268-121963290 GGGTAGCTGGAGACCCTGGTTGG - Intergenic
963097181 3:141556191-141556213 TGTTAGGTAGGGAGCTGGGTAGG - Intronic
966332187 3:178826539-178826561 AGTTAGCTAGAGATGCTGGTGGG - Intronic
971424965 4:26507154-26507176 TGTGACCTAGAGAGCATGGTTGG - Intergenic
974199770 4:58623030-58623052 AGGTAGCCAGAGACCCTGGTTGG - Intergenic
977379422 4:96252608-96252630 TCCTTGCTAGAAACCTTGGTAGG - Intergenic
979967176 4:127088917-127088939 AGGTGGCTGGAGACCTTGGTTGG - Intergenic
980945071 4:139311108-139311130 TGTTATTTAGAGACCTTCCTTGG + Intronic
985161017 4:187044793-187044815 AGTAAGCTATAGACCATGGTGGG + Intergenic
985681301 5:1257210-1257232 TCGGAGCTAGAGACCCTGGTGGG + Intronic
988128391 5:27073080-27073102 TGTTAGCTAGAGACCTTGGTGGG - Intronic
994430978 5:99660990-99661012 TGTTAGCTTGAGCGCTTGGATGG + Intergenic
997279346 5:132629292-132629314 TGTCTGATGGAGACCTTGGTAGG + Intronic
998713616 5:144854318-144854340 TTTTAGCTATAGAATTTGGTAGG + Intergenic
999959083 5:156735211-156735233 TGTCAGCCAGAGACCCTGGTTGG + Intronic
1002564282 5:180101151-180101173 TGCAAGCTCGAGACCTTGCTTGG - Exonic
1003480865 6:6531738-6531760 TTTTAGCCAGAGAACTTGGTTGG + Intergenic
1003761753 6:9186353-9186375 TGTCAGCTAGAGACTTTGCTAGG - Intergenic
1005368845 6:25108403-25108425 TTTGAGCTAGAAACCTTAGTTGG + Intergenic
1008173170 6:48234321-48234343 AGGTAGCTAGAGACCTCGGTTGG - Intergenic
1012839763 6:104315351-104315373 CTTTAGCTATAGACCCTGGTGGG - Intergenic
1015415954 6:132948911-132948933 TGTTACCTAAAGCCCTTGGGAGG + Intergenic
1017026615 6:150186657-150186679 TGTTTGCTAGAGGCCAAGGTGGG + Intronic
1023944223 7:44790877-44790899 TGCTTGCTAGAAAACTTGGTTGG + Intergenic
1025158786 7:56635157-56635179 TGGTAGCTGGAGACCCTGGTTGG - Intergenic
1025727822 7:64083099-64083121 TGGTAGCTGGAGACCCTGGTTGG + Intronic
1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG + Intergenic
1031969596 7:128054470-128054492 TGTGAGGTGGGGACCTTGGTAGG - Intronic
1031999419 7:128255022-128255044 TGATGGCTGAAGACCTTGGTGGG - Exonic
1032210322 7:129908295-129908317 TAATAGCTAGAAACCTTGATTGG - Intronic
1038509312 8:28116081-28116103 AGTTAGCTAATGACCTGGGTAGG + Intronic
1038874882 8:31537708-31537730 TGTCAGCTTGTGACCTTGGAAGG + Intergenic
1040091945 8:43408030-43408052 AGTTGGCTGGAGACCTGGGTTGG + Intergenic
1044125796 8:88457049-88457071 TGTTGGCTAGAGAGCTTGGGTGG - Intergenic
1044764903 8:95560958-95560980 TGTTAGTTTGAGAACTGGGTTGG - Intergenic
1050171937 9:2828991-2829013 TGTTAGCTGGTTAACTTGGTTGG - Intronic
1052378323 9:27742172-27742194 TGTCAGCTAGAGAGCTTGTGTGG + Intergenic
1054890876 9:70250432-70250454 GGTTAGCTAGAGTTCTTTGTTGG - Intergenic
1055208573 9:73762541-73762563 GGGTAGCCAGAGACCCTGGTTGG - Intergenic
1056127987 9:83555296-83555318 TGTTGGCTGGAGAGCTTGGGTGG + Intergenic
1059627349 9:116081190-116081212 TGTTAGCTATGGTGCTTGGTGGG - Intergenic
1061576808 9:131512506-131512528 GGACAGCTAGAGACCTTGTTTGG - Intronic
1186450452 X:9668877-9668899 AGTTATCTTGAGACCTTGGGTGG + Intronic
1186457166 X:9718798-9718820 TGTTAGGTAGAAACCTGGGCTGG + Exonic
1190600616 X:52088854-52088876 GGGTAGCTGGAGACCCTGGTTGG + Intergenic
1191739091 X:64417989-64418011 AGATGGCTGGAGACCTTGGTTGG + Intergenic
1191876942 X:65807061-65807083 GGTTGGCTGGAGGCCTTGGTTGG - Intergenic
1192891793 X:75398682-75398704 TGTTGGCTGGAGAGCTTGGGTGG - Intronic
1193432835 X:81432333-81432355 TTTTAGCTAGAGTCCTTCATAGG + Intergenic
1193762798 X:85488667-85488689 AGGTGGCTAGAGACCCTGGTTGG + Intergenic
1194067791 X:89283980-89284002 AGGTAGCTAGAGACCACGGTTGG + Intergenic
1194404002 X:93471209-93471231 TGTTAGGTAGAGTCTTTGGTAGG - Intergenic
1200721936 Y:6618140-6618162 AGGTAGCTAGAGACCACGGTTGG + Intergenic
1200770627 Y:7121964-7121986 TTTTATCAAGAGATCTTGGTTGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic