ID: 988129409

View in Genome Browser
Species Human (GRCh38)
Location 5:27083026-27083048
Sequence ATTCTGTTAGTCATGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988129409 Original CRISPR ATTCTGTTAGTCATGAAACT AGG (reversed) Intronic
901356922 1:8658336-8658358 CTTCTGTTTCTCATGCAACTAGG + Intronic
905736867 1:40334976-40334998 ATTTTGTTAGTTCTTAAACTGGG - Intergenic
907938321 1:59062835-59062857 ATTCTGTGAGTCAGGAATCTGGG + Intergenic
910742199 1:90532038-90532060 ATTATTTTAGAGATGAAACTAGG + Intergenic
910924626 1:92385807-92385829 TTTCTGTGAGTCAGGAATCTAGG + Intronic
911770957 1:101741896-101741918 ATTCTGTGAGTCATGTCAGTTGG + Intergenic
911970360 1:104427814-104427836 ATTGTGTCAGTCCTAAAACTTGG - Intergenic
916361803 1:163978479-163978501 ACTCTGTGTGTCATGAAATTGGG + Intergenic
918122845 1:181555144-181555166 ATTCTGTTAAAAGTGAAACTTGG - Intronic
918754048 1:188313611-188313633 ATTATGTGAGTTCTGAAACTAGG + Intergenic
919571936 1:199260016-199260038 TTTCTGTGGGTCAGGAAACTGGG - Intergenic
920422885 1:205847463-205847485 AATGTGTTAGTAATGAATCTGGG + Intronic
920423571 1:205854274-205854296 AATGTGTTAGTAATGAATCTGGG - Intergenic
923135430 1:231113816-231113838 GTACTGTAAGTCATGAAAATGGG - Intergenic
923803194 1:237230512-237230534 ATTCTGTTTTTCAAGAAACTAGG + Intronic
1063356646 10:5406468-5406490 TTTCTGTTACTCAAGAATCTTGG + Intergenic
1063532656 10:6849816-6849838 TTTCTGTAAGTCTTGAAATTAGG - Intergenic
1064121733 10:12624903-12624925 ATTCTGTCAGCCAGGAAACCTGG - Intronic
1065313969 10:24443748-24443770 ATTCTGTTAGGCATAATAATAGG + Intronic
1066064572 10:31752785-31752807 ATTCTGGGGGTCATGAAACCTGG + Intergenic
1069346218 10:67473033-67473055 ATTCAAGTATTCATGAAACTAGG - Intronic
1070292476 10:75127742-75127764 ATACTGTCTGTCATGTAACTGGG - Intronic
1070386505 10:75929518-75929540 AAACTGTTAGCCATGTAACTTGG - Intronic
1071910321 10:90224388-90224410 TTTCTGTCAGTCAGGAATCTGGG - Intergenic
1072702030 10:97649450-97649472 ATTCTGATAGGCAAGAAACCAGG - Intronic
1073839071 10:107477463-107477485 ATCATTTTAGTCATGCAACTTGG + Intergenic
1073899693 10:108205539-108205561 AATCTGTGAGACATAAAACTAGG - Intergenic
1074263312 10:111875679-111875701 TATCAGTAAGTCATGAAACTGGG + Intergenic
1074800551 10:116996762-116996784 AGTCTCTTAGTCCTGAGACTAGG - Intronic
1075668514 10:124247354-124247376 ATTCTGTGGGTCAGGAATCTAGG - Intergenic
1075849679 10:125576694-125576716 ATTCTATTAGTCAGGACTCTGGG + Intronic
1076081580 10:127586376-127586398 ATTCTATTAGTGAGGAAAATGGG + Intergenic
1077962969 11:7094910-7094932 ATTCTGTTATTCATGTAGCTTGG + Intergenic
1079622589 11:22572272-22572294 ATTCTGTTATTCAGCAATCTGGG + Intergenic
1080199049 11:29647265-29647287 ATACTGTTAGTTATAAAATTAGG - Intergenic
1080327063 11:31087891-31087913 GTTCTGTTAATTATGAAACAGGG + Intronic
1080370179 11:31629585-31629607 ATGCTGTTAGGTATGAAATTAGG - Intronic
1081396072 11:42587725-42587747 ATTCTGTTATCCTTGTAACTAGG - Intergenic
1082932307 11:58621225-58621247 ATTCTGTTATTCAGCAAACTTGG + Intronic
1083746469 11:64739792-64739814 ACTGTGATAGTCCTGAAACTGGG + Exonic
1083866724 11:65458838-65458860 TTTCTGTAAGTCAAGAACCTGGG + Intergenic
1084361947 11:68674382-68674404 ATTCTGTTATTCATGCATCACGG + Intergenic
1084442133 11:69180609-69180631 ATGCTGCTGGTCATGAGACTCGG - Intergenic
1086473568 11:87144781-87144803 ATTTTGTTAGTGATGTATCTGGG + Intronic
1088112801 11:106281409-106281431 ATTTTATTAGTGAGGAAACTGGG + Intergenic
1089941117 11:122418587-122418609 AGTCTCTTAGTCATGAGAATAGG - Intergenic
1090024298 11:123154457-123154479 CTTGTGTTAGTCATGCAAGTAGG + Intronic
1092297425 12:7211484-7211506 GTTCTGCTGGTCATGAAGCTGGG + Intronic
1092850958 12:12626097-12626119 ATTCTGTTTGTCCTGAAAAATGG + Intronic
1093507636 12:19887008-19887030 ATTTTATTAGCCATTAAACTTGG + Intergenic
1094685425 12:32708784-32708806 ATACTGTTAATCTTGACACTAGG + Intronic
1096443182 12:51663664-51663686 ATTCTGTTATTCATGCAAGTAGG + Intronic
1098340143 12:69443062-69443084 TTTCTGTGAGTCAGGAATCTGGG + Intergenic
1098784651 12:74736578-74736600 ATTCTGTAACTCATGAAATTAGG - Intergenic
1098903380 12:76135746-76135768 ATTCTGTGAGTCAGGAATTTGGG - Intergenic
1099247400 12:80210150-80210172 ATGCTGATAGTTATGGAACTGGG - Intronic
1099351126 12:81569948-81569970 ATTCTCTCAGTTATCAAACTTGG - Intronic
1099938492 12:89157028-89157050 GTTCTCTTAGTCATGAATTTTGG - Intergenic
1100855951 12:98757342-98757364 ATTCTGTAAGTCAGGGATCTGGG - Intronic
1101040475 12:100750482-100750504 ATGCTGTCAGTCATGGAGCTTGG + Intronic
1102019470 12:109671696-109671718 TTTCTGTGAGTCAGGAACCTGGG - Intergenic
1103173477 12:118842691-118842713 TTTCTGTTGGTCAGGAATCTGGG + Intergenic
1103420307 12:120775570-120775592 ATTCTGTTAGTCCCTGAACTAGG + Intronic
1106283400 13:28297461-28297483 ATTCTGTGGGTCAGGAATCTGGG + Intergenic
1107141504 13:37003170-37003192 GTTCACTTAGTCATTAAACTTGG - Intronic
1107627241 13:42301703-42301725 ATTCTGAGAGTCAGGAAATTTGG - Exonic
1107896999 13:44975239-44975261 GTTTTTTGAGTCATGAAACTGGG - Intronic
1108238656 13:48437444-48437466 ATTCTGAAAGTCGGGAAACTGGG + Intronic
1108794363 13:54013208-54013230 ATTATTATAGTCCTGAAACTTGG - Intergenic
1110251952 13:73390237-73390259 ATTCTCTTCCTCTTGAAACTGGG + Intergenic
1110368473 13:74714632-74714654 ATGCTGTTATTCATGACTCTAGG - Intergenic
1111305107 13:86400897-86400919 ATTTATTTAGTCAAGAAACTGGG - Intergenic
1112337415 13:98526689-98526711 ATTCTGTTTTTCAAGAAACTTGG + Intronic
1112753432 13:102605087-102605109 TTTCTGTGAGTCAGGAATCTGGG + Intronic
1113106260 13:106774881-106774903 ATCTTGTTAGTCAAGGAACTTGG - Intergenic
1113144506 13:107193045-107193067 GTACTGTTAGTCATTAAACTAGG + Intronic
1114406056 14:22457339-22457361 CTCCTGTTAGCCCTGAAACTGGG + Intergenic
1115926859 14:38445723-38445745 ATTCTTTCAGTCATGAACATAGG + Intergenic
1118940111 14:70326414-70326436 ATTCTTCCAGTCATCAAACTTGG + Exonic
1119101569 14:71884743-71884765 ATTCTCTTAGTCATGACAAATGG - Intergenic
1120614912 14:86691586-86691608 GTTCTGTTTGTTTTGAAACTTGG + Intergenic
1122079047 14:99254337-99254359 ATTCTGTCAGTCATCACACTAGG - Intronic
1123633298 15:22276908-22276930 CTTCTGTTTCTCATGCAACTAGG - Intergenic
1125385613 15:39133367-39133389 ATTCTCTTAGTCATGCATCAAGG + Intergenic
1126200905 15:45984807-45984829 ATTCTGTAAGTCATGAGTCCGGG - Intergenic
1126905934 15:53365540-53365562 ATTCTCTGAGCCATGAAGCTTGG + Intergenic
1127411699 15:58714193-58714215 ACTCTGTTAATCAGAAAACTTGG + Intronic
1128171176 15:65514816-65514838 AGTCTGTTAGATATAAAACTGGG - Intronic
1128882972 15:71260565-71260587 ATTTTGTTGGTCATGTTACTGGG + Intronic
1131953566 15:97707058-97707080 ATTCAGATACTCATGGAACTGGG - Intergenic
1131954352 15:97716238-97716260 ATTCTGTCAAACATGAATCTAGG - Intergenic
1132595694 16:748283-748305 AGCCTGTTATTCATAAAACTTGG + Intronic
1133574139 16:7071347-7071369 GATTTGTTAGTCATGAAATTAGG + Intronic
1140890932 16:79284620-79284642 ATAATGTTAGTCATAAAACAAGG + Intergenic
1144524224 17:15976555-15976577 TTTCTGCTACTCAGGAAACTTGG - Exonic
1146995060 17:37313050-37313072 CTAATGATAGTCATGAAACTGGG - Intronic
1148965190 17:51429119-51429141 GTTCTGTTGGTCAGGAATCTGGG + Intergenic
1149415756 17:56458298-56458320 ATTTTGCAAGTGATGAAACTGGG - Intronic
1150964686 17:69954416-69954438 ATACAGTTAGTCATGGAGCTGGG - Intergenic
1151565424 17:74894662-74894684 ATCCCTTAAGTCATGAAACTGGG - Intergenic
1152371481 17:79891210-79891232 ATTCTGGCAGTCATAAAGCTTGG + Intergenic
1153500922 18:5749042-5749064 TTTCTGTGAGTCAGGAATCTGGG - Intergenic
1159348236 18:67235268-67235290 AGTCTGTTAGTTATTAAATTGGG - Intergenic
1159483944 18:69028764-69028786 TCTCTGTTACTCAGGAAACTTGG - Intronic
1159685551 18:71414534-71414556 ATTCTGTTAGGCACACAACTTGG - Intergenic
1164895084 19:31869523-31869545 ATTTTCCTAGTCATGAATCTTGG - Intergenic
1168510703 19:56971376-56971398 TTCCAGTGAGTCATGAAACTTGG - Intergenic
926304091 2:11625382-11625404 ATTTTGTTAGGCATGAAATCAGG + Intronic
926469101 2:13230818-13230840 AATATGCTAGTTATGAAACTAGG - Intergenic
926527855 2:14004974-14004996 ATTCTCTTAGAAAGGAAACTTGG + Intergenic
929217106 2:39426051-39426073 AATCTGATAGTGAAGAAACTTGG + Intronic
931462293 2:62459464-62459486 AATCAGTTGGTCAAGAAACTTGG - Intergenic
933295194 2:80482196-80482218 AGTCTGTCAGACATGAATCTGGG + Intronic
938593613 2:132764356-132764378 ACTCTGTTTGTCATGAAGTTAGG - Intronic
939499674 2:142967768-142967790 ATGCTTTTAGTCCTGAAAATTGG + Intronic
939592586 2:144083457-144083479 ATTCTGTGAGTCAAGAATTTGGG - Intronic
940738159 2:157477400-157477422 CTTTAGTTAGTCATGAAACCAGG - Intronic
940985911 2:160052170-160052192 ATTGTGTGCCTCATGAAACTTGG - Intronic
941467047 2:165840297-165840319 TTTCTGTGAGTCAGGAGACTGGG - Intergenic
944177944 2:196854559-196854581 ATGCTGTCAGTCATGATTCTAGG + Intronic
944768946 2:202893996-202894018 GTTCTCTTATTCAGGAAACTTGG - Intronic
945316142 2:208372734-208372756 ATTCTATTAATGATGAAATTAGG + Intronic
945688585 2:213004787-213004809 TTTCTGTTCCTCATGAAGCTAGG + Intronic
946599404 2:221342949-221342971 TTTCTGTGAGTCAGGAATCTAGG + Intergenic
946720485 2:222601056-222601078 AGTATCTAAGTCATGAAACTCGG + Intronic
947553109 2:231061880-231061902 TTTCTGTTGATAATGAAACTGGG - Intronic
948037183 2:234867291-234867313 ATTCTGTAAGTCAGGAATTTAGG + Intergenic
1169911269 20:10649481-10649503 ATTTTGATTTTCATGAAACTTGG - Intronic
1169955052 20:11092742-11092764 ATTCTGTTACTCATGGAAGTTGG + Intergenic
1173012663 20:39196298-39196320 ATTTTGTTAGTCATTAATCAAGG + Intergenic
1177663078 21:24113240-24113262 ATTCTCTAAGTTATGAAATTTGG + Intergenic
1178164265 21:29954343-29954365 ATCCTCTTAGACATGAAGCTCGG + Intergenic
1178406737 21:32330659-32330681 AATCTGTTACTCATCAAACATGG - Intronic
1178637644 21:34318839-34318861 GTTCTGTTAGTAGTGAAACAGGG + Intergenic
1181682388 22:24504565-24504587 GTTCTTTTAGTCTAGAAACTTGG + Intronic
1182104925 22:27682525-27682547 AATCTGTAATGCATGAAACTGGG + Intergenic
1182970634 22:34571965-34571987 CTTCTGTAAGTCATGAAATCAGG + Intergenic
1183019259 22:35014195-35014217 TTTCTGGGAGTCAGGAAACTGGG + Intergenic
1183655479 22:39182101-39182123 ATTCTGTGGGTCATGAACTTGGG - Intergenic
950202050 3:11051480-11051502 ATTCTGTTAGGCATACACCTAGG - Intergenic
951486433 3:23216866-23216888 ATTCTATCAGTCATGATGCTTGG + Intronic
952031372 3:29146509-29146531 ATTCTGCTTTTCATAAAACTTGG - Intergenic
952165077 3:30739135-30739157 ATTCTGTAATTCAGGAAGCTAGG - Intronic
953181798 3:40602576-40602598 ATTCTGTGAGTCAGGAATTTGGG + Intergenic
953287719 3:41629146-41629168 ATTCTGTGGGTCATGAATTTCGG + Intronic
953940829 3:47095093-47095115 ATTCTGTAAGTTTTGAAAATAGG + Intronic
955346180 3:58163589-58163611 GTTCTGAAAGTCAAGAAACTTGG - Intronic
956276126 3:67503034-67503056 AATCTGTTATTCATAAAAATAGG - Intronic
956689206 3:71860639-71860661 ATTCTGTGGGTCATGAAAGGTGG - Intergenic
956813084 3:72883722-72883744 TTTCTGTCAGTCAGGAATCTAGG - Intergenic
957695530 3:83634052-83634074 TTTCTGTTATTCATGAGACAGGG - Intergenic
957808771 3:85189691-85189713 ATTCTGTGAGTCATGAATCAAGG + Intronic
957937923 3:86968243-86968265 ATTCTGTTAGGCCTGACACATGG + Intronic
957960641 3:87246784-87246806 ATACTGTTAGTCATCAAAAGAGG + Intronic
958514811 3:95100634-95100656 ATTCTGTTAGGAATATAACTAGG - Intergenic
958742165 3:98087803-98087825 ATTATGATAGTCATTAAAGTGGG - Exonic
959851612 3:111095154-111095176 ATACTGTCAGTCATGCCACTAGG + Intronic
963627053 3:147686810-147686832 AGTCAGGTAGTCATGAATCTAGG + Intergenic
963671844 3:148260639-148260661 TTTGTGTAAGTCATGATACTAGG + Intergenic
964934646 3:162067621-162067643 GTTCTTTTAGTCATGATATTAGG - Intergenic
966358514 3:179108319-179108341 TTTCTGTGAGTCAAGAATCTGGG + Intergenic
967237205 3:187397010-187397032 ATTCTGTGGGTCATGAACTTAGG - Intergenic
969327973 4:6454632-6454654 ATTCTGTGAGTCAGGAATTTGGG - Intronic
969960104 4:10936050-10936072 ATTCAGTTAGTGATTAAACACGG - Intergenic
972217413 4:36912319-36912341 ATTCAGTTGGTCATGTAAATGGG - Intergenic
973017355 4:45157502-45157524 TTTTTGGTAGACATGAAACTGGG + Intergenic
974057146 4:56995587-56995609 CTTCTGTGAGTCAGGAATCTGGG + Intronic
974788892 4:66659585-66659607 ATTCTATAAGAGATGAAACTGGG - Intergenic
977302774 4:95286824-95286846 CTTCTGTTAGTCATCAGATTTGG - Intronic
977600841 4:98931923-98931945 TTTCTGTTAATCAAAAAACTCGG + Intergenic
978040245 4:104051530-104051552 ATTCTGTGAGTCAAGAATCCAGG - Intergenic
978493744 4:109336342-109336364 ACTCTGTAAGTCTGGAAACTAGG + Intergenic
978508745 4:109492044-109492066 TTTCTGTTAGTTTTGAAGCTTGG - Intronic
978630762 4:110741349-110741371 ATGCTGTTAGACATGAAATTGGG - Intergenic
979083102 4:116368147-116368169 AATCATTTAGTAATGAAACTAGG - Intergenic
979117283 4:116841718-116841740 ATTCTGTTTGTTATGATATTGGG - Intergenic
980272413 4:130602460-130602482 TTTCTGTAAGTCAGGAATCTTGG - Intergenic
980386836 4:132097086-132097108 TGTCTTTTAGTCATGAATCTAGG + Intergenic
980446566 4:132918060-132918082 TTTCTGAGAGTCAGGAAACTGGG + Intergenic
981942902 4:150304731-150304753 ATTCTGTTTGTCATGTAAATTGG - Intronic
982477023 4:155866263-155866285 ATACTGTTATTGATGAAAATTGG - Exonic
982912440 4:161161435-161161457 TTTCTATTAGGTATGAAACTTGG + Intergenic
983486521 4:168338016-168338038 ACTATGATAGTCATGGAACTTGG - Intergenic
983801343 4:171933879-171933901 ATTCTTTTAGTCATAAAATTTGG + Intronic
984144192 4:176041341-176041363 ATTCTTTTAGTTGTGACACTAGG + Intergenic
984368102 4:178824109-178824131 TTTCTGAGGGTCATGAAACTGGG - Intergenic
986590743 5:9366792-9366814 ATTCTATTGCTCTTGAAACTAGG - Intronic
986845614 5:11749233-11749255 ATTCTGTGAGTCAAGAATCTAGG - Intronic
987641641 5:20619610-20619632 ATTCTATGAGTCATGAGACTTGG - Intergenic
988129409 5:27083026-27083048 ATTCTGTTAGTCATGAAACTAGG - Intronic
989044137 5:37257877-37257899 ACACTGTCAGTCATGATACTGGG + Intergenic
989448553 5:41560146-41560168 ATTCTGTTGCTAAGGAAACTGGG - Intergenic
990529905 5:56663094-56663116 CCTCTGTTAGACATGAAGCTGGG - Intergenic
990669027 5:58106202-58106224 ATTCCGTAAGTCAAGAAAGTGGG - Intergenic
992825438 5:80545514-80545536 ATTCTCTTACTGATGAAAATTGG - Intergenic
993697202 5:91075640-91075662 ATTCTAATAGTCATTATACTTGG + Intronic
994942169 5:106338682-106338704 ATTCTATTTTCCATGAAACTAGG - Intergenic
995331461 5:110951544-110951566 ATTCCATTAGTTATGAAACTTGG + Intergenic
1000409196 5:160919968-160919990 TTTCTGTTTGTCAAGAAACAGGG + Intergenic
1000873602 5:166607368-166607390 AGTCTGTAAGTCATGAACCCAGG - Intergenic
1003233871 6:4278547-4278569 ATTCTCTTAGGCATGTATCTAGG + Intergenic
1005232096 6:23714007-23714029 TTGCTGTTAGTCATGTAAATTGG - Intergenic
1005383774 6:25264932-25264954 GTTCTGTCAGTTCTGAAACTAGG + Intergenic
1006016431 6:31084976-31084998 ATACTGTTAGTCATGATATGCGG - Intergenic
1006483274 6:34316250-34316272 ATTCTGTCAGTTAAGAGACTTGG - Intronic
1006614495 6:35317224-35317246 AGTCTGTTAGTGATGAGGCTTGG - Intronic
1008012519 6:46483405-46483427 ATTCTGTTTGTAATCACACTGGG - Intronic
1008139161 6:47811981-47812003 ATTCTGTTTGGCATGACAATAGG - Intronic
1008199432 6:48568061-48568083 GTTCTGTTAGGCATGAAGTTTGG - Intergenic
1008567727 6:52785845-52785867 ATTTTGTTAATCATTAATCTAGG + Intergenic
1008571861 6:52824675-52824697 ATTTTGTTAGTCACTAATCTAGG + Intergenic
1009240265 6:61177616-61177638 ATTCTCTTAGTACTGAAAATGGG - Intergenic
1010032030 6:71281421-71281443 TTTCTGTTGGTCAGGAATCTAGG + Intergenic
1012446367 6:99311231-99311253 ATTTTATAAGTCATGAAACAAGG - Intronic
1013301002 6:108804879-108804901 TTTCTGTGAGTCAGGAACCTGGG + Intergenic
1013487813 6:110614861-110614883 ATTCTGGCAGGCATGAAATTTGG + Intronic
1014922125 6:127225660-127225682 ATTCTGTGAGTCAGGAATTTGGG + Intergenic
1014967735 6:127776635-127776657 TTTCTGTGAGTCAAGAATCTGGG - Intronic
1015741608 6:136461155-136461177 ATTCTCTTAGTTATAAAACATGG - Intronic
1015986361 6:138887942-138887964 AATCCTTTATTCATGAAACTGGG + Intronic
1016070898 6:139737761-139737783 GTTCTGTTAGTGAAGAAACATGG + Intergenic
1016872228 6:148829632-148829654 CGTCTGTGAGTCATGAAACCAGG - Intronic
1016983571 6:149876622-149876644 ATTCTGTGGGTCAGGAAATTTGG + Intergenic
1018523628 6:164681326-164681348 AGCCAGTTAGTCATGAAACCAGG - Intergenic
1018537960 6:164843321-164843343 ATTCTGATAACCATGAAATTTGG + Intergenic
1018885088 6:167928527-167928549 ATTCTGCCAGTTATGAACCTGGG + Intronic
1020090537 7:5336990-5337012 TTTCTGTTTGTCATCAAATTTGG - Intronic
1021519295 7:21523113-21523135 TTTCTGTTGGTCAAGAATCTAGG - Intergenic
1024996827 7:55278639-55278661 ATTCTGCTTCTCAGGAAACTAGG + Intergenic
1031014167 7:116554790-116554812 ATTCTTTGAATCATCAAACTGGG + Intronic
1031695138 7:124842616-124842638 ATTCTGATAGTAATAAAAGTGGG - Intronic
1034787692 7:153940549-153940571 TTTCTGTGTGTCATGAAACATGG - Intronic
1036079958 8:5544253-5544275 CTTCTGTGAGTTATGAAATTTGG + Intergenic
1036474739 8:9082908-9082930 ATTTTGTAAGTCATAAAAGTAGG + Intronic
1036573236 8:10000221-10000243 ATTTTGGAAATCATGAAACTAGG - Intergenic
1037257662 8:16973289-16973311 ATTTTGTTTGCCCTGAAACTGGG - Intergenic
1037268266 8:17093318-17093340 TTTCTGTCAGCAATGAAACTAGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041326893 8:56677319-56677341 ATTGTGTAAGTCATGAAAATTGG + Intergenic
1043163573 8:76875295-76875317 ACACTGTTAGTCATGCAGCTGGG - Intergenic
1043292789 8:78624175-78624197 ATTCTGTTAGTGATCTAAGTTGG + Intergenic
1046355108 8:113072818-113072840 ATTCTGTTGGTCTTTAACCTGGG + Intronic
1047385227 8:124403073-124403095 ATTCTGTTAGCCTTGAAAAGTGG + Intergenic
1048903155 8:139059863-139059885 ATTCTGTTAGTAGTTAAGCTAGG + Intergenic
1050428474 9:5536733-5536755 ATAGTGTTGGTCATCAAACTGGG + Intronic
1050787607 9:9425271-9425293 ATTCTGAACGTCATGGAACTGGG - Intronic
1055178106 9:73346111-73346133 AATATGTCAGTCATGAAAATAGG - Intergenic
1056064460 9:82919226-82919248 ATTCTTTTAGTACTGAAACATGG - Intergenic
1056566133 9:87774168-87774190 ATTCTGCTACTAATGACACTGGG + Intergenic
1059360360 9:113737311-113737333 ATTCTCTTACTAATGAATCTTGG + Intergenic
1059482966 9:114606313-114606335 ATGCTGTTTGTCAGGAAACCGGG - Intergenic
1060362146 9:122969620-122969642 ATTTTGTTAGTCATTCTACTAGG - Intronic
1061726304 9:132583789-132583811 GTTCTGTGAGTCATGAAAAGAGG + Intronic
1186111562 X:6262917-6262939 TTTCTGTAAGTCAGGAATCTAGG + Intergenic
1189300800 X:39951000-39951022 ATTCTGTGGGTCAGGAATCTGGG + Intergenic
1189486077 X:41433240-41433262 ATTCTGTTAGCCATGTAGATGGG + Intergenic
1190016522 X:46832132-46832154 TTTCTTTTACTCATGAACCTTGG - Intergenic
1191837510 X:65480057-65480079 ATTCTGTTAGGCAGGAAAATAGG - Intronic
1192830615 X:74747380-74747402 AGTCTCTTGGTCAGGAAACTTGG - Intronic
1193321657 X:80129984-80130006 TTTCTGTGAGTCAGGAATCTAGG - Intergenic
1193872521 X:86818307-86818329 ATTCTTTTAGCCAGGAAAATAGG + Intronic
1194126761 X:90028092-90028114 ATTATGTTTGTCATGAATATCGG + Intergenic
1194587151 X:95749534-95749556 ATTCTGATAGTCATAAAATCTGG - Intergenic
1194767590 X:97860161-97860183 ATTTTGTCAGTGAGGAAACTGGG - Intergenic
1195405424 X:104507900-104507922 ATGCTGTTACTGATGACACTAGG - Intergenic
1197355097 X:125429862-125429884 TTGCTGTTAGTCAGGAATCTAGG + Intergenic
1198999396 X:142616457-142616479 ATTCTTTTCTTCATGAATCTTGG - Intergenic
1200731743 Y:6750011-6750033 ATTCTTTTAGTCATGATGTTAGG + Intergenic