ID: 988131883

View in Genome Browser
Species Human (GRCh38)
Location 5:27116983-27117005
Sequence ACATATGCATGTTGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988131883_988131887 15 Left 988131883 5:27116983-27117005 CCCATTTCCCAACATGCATATGT 0: 1
1: 0
2: 1
3: 21
4: 216
Right 988131887 5:27117021-27117043 TTATTTGACACTCTTACCCTCGG 0: 1
1: 0
2: 0
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988131883 Original CRISPR ACATATGCATGTTGGGAAAT GGG (reversed) Intronic
905917181 1:41693561-41693583 ACATAGGCATGATGGGTAAAAGG - Intronic
906773841 1:48510681-48510703 ACCTAAGCATGATGGGAAAAGGG + Intergenic
907352952 1:53848543-53848565 AGAAATGAATGTTGGGAAAATGG - Intergenic
907656613 1:56349107-56349129 ACATATGCAGGTTTGTACATGGG - Intergenic
908073294 1:60487548-60487570 TGATATGGATGTAGGGAAATTGG + Intergenic
910359897 1:86405065-86405087 ACATATGAATTTTGGGGAGTGGG + Intergenic
910499874 1:87877962-87877984 ACATATACATGTTAGAGAATGGG - Intergenic
912685400 1:111758230-111758252 ACATATTCATTTTTAGAAATAGG + Intronic
913536294 1:119775643-119775665 ACATATGCCTGGAGGGACATAGG + Intergenic
915788591 1:158643051-158643073 AAAGAGGCATGTTGGCAAATGGG - Intronic
917156262 1:172002528-172002550 TTATCTGCATGTTGAGAAATGGG + Intronic
919202731 1:194378377-194378399 ACAAATACATGTTTGGAAAATGG - Intergenic
920251548 1:204625507-204625529 ACCTATGCATGTTGGGATCAGGG - Intronic
922712860 1:227846072-227846094 ACATATCCATTTTGAGAAATAGG - Exonic
1063918260 10:10906140-10906162 GCCTATGCATGTTGGGAATGAGG - Intergenic
1064276599 10:13912048-13912070 GCATATTCATTTTGGGAAACTGG - Intronic
1066232592 10:33451313-33451335 ACATATGCATTTTGGGGGTTGGG + Intergenic
1066452707 10:35545648-35545670 ACATATGCATTTTGGAAGAGGGG + Intronic
1071515191 10:86292363-86292385 ACATTTCCCTGTTGGGAAAATGG + Intronic
1072515158 10:96174825-96174847 ACATATGCATTTGGGGGAGTGGG - Intronic
1072826527 10:98612159-98612181 AAACAGGCATGTTGAGAAATTGG - Intronic
1074376725 10:112946929-112946951 GGCTCTGCATGTTGGGAAATGGG - Intergenic
1075518153 10:123126125-123126147 ACATATGAATTTTGGGAGAGGGG - Intergenic
1075992264 10:126848153-126848175 ACATGGGCATGTTGGAAAAGGGG - Intergenic
1079886644 11:25998856-25998878 ACAAATGTATGTTGAAAAATTGG - Intergenic
1080920876 11:36708261-36708283 AAATATACCTGTTGGGCAATAGG + Intergenic
1081577986 11:44331619-44331641 ACATGTCCTGGTTGGGAAATGGG + Intergenic
1082126856 11:48442795-48442817 ACATATCCAAATTGGAAAATAGG - Intergenic
1083061795 11:59880816-59880838 AAACTTGCATGTTGGTAAATTGG + Intergenic
1083271071 11:61572932-61572954 ACACATGCATGTTGGCATTTGGG - Intronic
1083573891 11:63775484-63775506 TCATACGGATGTGGGGAAATCGG - Intergenic
1085968747 11:81561262-81561284 ACATATAAATGTTGGGGAGTGGG + Intergenic
1086608281 11:88723903-88723925 ACATGTGCATGTTGCTATATGGG + Intronic
1087821777 11:102720489-102720511 ACATACCCATGTTGAGAAAATGG + Intronic
1088703424 11:112435612-112435634 ATATATGCATGTTAAGAAACAGG + Intergenic
1088877453 11:113947758-113947780 ACATATGAATTTTGGGGAGTGGG + Intergenic
1090469132 11:126963909-126963931 ACAAGTGCAGGTGGGGAAATGGG - Intronic
1090562639 11:127949079-127949101 ACATATGAATCTTGTGAATTTGG + Intergenic
1092581038 12:9841752-9841774 ACATATGCATCTCTGAAAATTGG - Intronic
1092858307 12:12695717-12695739 ACTTATGCATGTTTGTAAACAGG - Intronic
1093329651 12:17819830-17819852 ACATATGCATGTTTTCAAAAAGG + Intergenic
1093740647 12:22681859-22681881 ACACATGCATGTTGGAAAAGAGG + Intronic
1094081720 12:26543837-26543859 AAATATGTATGTTGGAACATTGG - Intronic
1094777634 12:33749572-33749594 TCATAGGAATGTTGGTAAATAGG - Intergenic
1095244646 12:39904824-39904846 ACATTTCCATCTTGGGATATAGG - Intronic
1096834751 12:54342647-54342669 TCATATACAAGTAGGGAAATAGG + Intronic
1097006108 12:55919084-55919106 ACATATGCAAGATGGGAATATGG + Intronic
1097281675 12:57848346-57848368 CCTGATGCATGTTGGGCAATGGG - Intergenic
1098111057 12:67122309-67122331 GCACATGCCTGTTGGGAAAGGGG + Intergenic
1098262811 12:68687897-68687919 ACAGATGCAGGTTGGCAATTTGG - Intronic
1098483734 12:70996734-70996756 ACATCTGCATTTTGGCCAATAGG - Intergenic
1099945430 12:89238669-89238691 AAAGATGCATGTTGGGTAATTGG - Intergenic
1100013887 12:89985446-89985468 ACATAGGAATGGTGGGAAAGAGG - Intergenic
1100726355 12:97413177-97413199 ACATGTGGATGTTTGGAATTAGG + Intergenic
1101451541 12:104784181-104784203 ACACATGCATGTTTGAAGATAGG - Intergenic
1101451545 12:104784303-104784325 ATATATGCATGTTTGCATATAGG + Intergenic
1101582365 12:106053213-106053235 ACATAGGCCCCTTGGGAAATGGG - Intergenic
1104237339 12:126951714-126951736 GCATAAGCTTGTTGGGAAGTTGG + Intergenic
1104477183 12:129080518-129080540 ACATATCCATTCTGGAAAATTGG - Intronic
1105965591 13:25381361-25381383 AAATAAGCATGTTGGAAAAATGG + Intronic
1106293513 13:28388683-28388705 ACATTTGCATATGGGGAAAGTGG + Intronic
1107804267 13:44139839-44139861 ATGTATGCATGTTGGGAGGTTGG + Intergenic
1110865158 13:80385446-80385468 ACATGTGGATTTTGGGGAATAGG + Intergenic
1110963974 13:81667532-81667554 AAATATTCATGTTTGGAAACAGG - Intergenic
1111346368 13:86959697-86959719 GCATATACATGTTGGCAGATAGG + Intergenic
1112186228 13:97130378-97130400 ACATCTTCATATTGGGAAATAGG - Intergenic
1114924091 14:27371642-27371664 ACATTTGCATGAGTGGAAATAGG + Intergenic
1116450659 14:45060963-45060985 GCATATGTATGGTGAGAAATAGG - Intronic
1117055478 14:51907908-51907930 ATATGTGCAGGTTGGGAAATAGG + Intronic
1119235205 14:73013790-73013812 ACATTTGCTTGATGGGAAATCGG - Intronic
1121591014 14:95109614-95109636 AAACATGCATTTTGGGAAAATGG + Intronic
1123790382 15:23714007-23714029 ACATTTGAATGTAGGCAAATAGG - Intergenic
1124000648 15:25756870-25756892 ACATTTGCATGTTGTAAAAATGG + Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1126307966 15:47282893-47282915 GCATGAGAATGTTGGGAAATAGG - Intronic
1126347556 15:47712033-47712055 AAATCTGCATGGTGTGAAATAGG + Intronic
1126691168 15:51289932-51289954 ACAGAGGCATGGTGGGAAGTTGG - Intronic
1126790287 15:52215202-52215224 AAATATGAATGTGGGAAAATGGG + Intronic
1128827694 15:70735307-70735329 ACATATGCATGTTTGTTACTTGG - Intronic
1129286688 15:74531220-74531242 TCATCAGCATGTTGGCAAATCGG + Intergenic
1129982839 15:79890003-79890025 ACAGATGGATTTTAGGAAATGGG - Intronic
1135669546 16:24363372-24363394 ACATATGCATTTTGGGGGAATGG + Intergenic
1137876198 16:51998897-51998919 GCATATGCATGTGGGGAAGAAGG + Intergenic
1139906869 16:70372175-70372197 AAATTTGCATTTTGGAAAATTGG + Exonic
1140427289 16:74871431-74871453 AAATATTCATGTTTGGAAACAGG - Exonic
1140672567 16:77293413-77293435 AGATATGTATGGTGGGTAATGGG - Intronic
1142576361 17:911062-911084 ACATATGCACTGTGGGAACTTGG - Exonic
1146223230 17:31044525-31044547 AAATATGTATGTAGGTAAATGGG + Intergenic
1146341767 17:32025461-32025483 AAATATGTATGTAGGTAAATGGG - Intronic
1146351037 17:32094170-32094192 AAATATGTATGTAGGTAAATGGG + Intergenic
1146498679 17:33345626-33345648 ACATATTCAAGTTGGGAACAAGG + Intronic
1147233222 17:39034912-39034934 AAATATGTATGTAGGCAAATGGG - Intergenic
1148362366 17:47022595-47022617 AAATATGTATGTAGGTAAATGGG - Intronic
1149389834 17:56177373-56177395 ACATATGCATCATGGAAAATGGG - Intronic
1150783852 17:68146762-68146784 AAATATGTATGTAGGCAAATGGG + Intergenic
1151039455 17:70841648-70841670 ACATATGCATAATGGGAGAATGG + Intergenic
1151412267 17:73938938-73938960 ACCTGTGCAAGTTAGGAAATGGG + Intergenic
1151643646 17:75414792-75414814 ACATATGGATTTTGGGGAAAAGG - Intergenic
1152431965 17:80253335-80253357 ACATATGCATGTTTGGGGAGGGG - Exonic
1152533124 17:80932130-80932152 ATATATGCATGCCTGGAAATGGG - Intronic
1158821511 18:61164826-61164848 ACATCTTCATGTTCAGAAATAGG + Intergenic
1158872017 18:61697348-61697370 ACATCTGGAAGATGGGAAATAGG - Intergenic
1160491493 18:79340566-79340588 AAATATGCATTTTTGGAAACAGG - Intronic
1161661113 19:5546879-5546901 AAATATGGATGTGGGGGAATAGG + Intergenic
1162214234 19:9119287-9119309 ACATATGCAAGTTTGTACATAGG + Intergenic
1165741804 19:38209373-38209395 ACATTTGCATTTTGGGAACCGGG + Intergenic
1167228254 19:48264595-48264617 ACATAAGCTGGCTGGGAAATGGG - Intronic
925095597 2:1197446-1197468 ATATATGCATGCTCTGAAATTGG - Intronic
926622928 2:15063531-15063553 ACATATGAATTTTGGGAAAGGGG - Intergenic
926846450 2:17146507-17146529 GCATATGCATGTGGGGAATGGGG + Intergenic
928611501 2:32996432-32996454 ACATATGAATTTTGGGAGAGTGG + Intronic
928739548 2:34334034-34334056 ATAAATGCATGATGGGGAATGGG - Intergenic
929072259 2:38044498-38044520 ACATATGCATAATGGGAAATGGG - Intronic
929816768 2:45238665-45238687 ACATATGTATTCTGGGGAATGGG + Intergenic
930516855 2:52419583-52419605 ACATATAGATGTTGTGAAAAAGG - Intergenic
931326169 2:61226368-61226390 ACAAATGCATTTTAGCAAATGGG + Intronic
932064521 2:68539590-68539612 ACATATGAATTTTGGGAGGTGGG + Intronic
932372544 2:71203485-71203507 ACTCATGAATGTTGGGAAACGGG - Intronic
933539734 2:83624195-83624217 AAATATGCCAGTAGGGAAATTGG + Intergenic
935293138 2:101626512-101626534 ACATATGAATTTTGGGAGGTAGG + Intergenic
935926060 2:108070183-108070205 ACATTTGCATGTTGGAGAAGTGG - Intergenic
937419585 2:121742470-121742492 TCATATTCATGTTGGGAAAGGGG + Intronic
937769860 2:125707797-125707819 AAATAAGCATGTTGGGGTATTGG - Intergenic
937857721 2:126684607-126684629 ACAAATGCATGTGGGTAAGTTGG - Intronic
940442784 2:153738323-153738345 AAATTTCCATGTTGGGACATGGG - Intergenic
941437982 2:165495572-165495594 ACATATGAAGGTTGTGAAATAGG + Intronic
941607425 2:167617114-167617136 ACATATGGAGGGTGGGACATAGG - Intergenic
943823582 2:192359582-192359604 ACATGAGCATATTTGGAAATGGG - Intergenic
948767796 2:240232595-240232617 CCAGGTGCATGTGGGGAAATCGG - Intergenic
1170575906 20:17661319-17661341 CAATTTGCATGTTGGGAAACAGG + Intronic
1170774134 20:19360516-19360538 ACATTTTCATGTTGAGAAGTTGG - Intronic
1171236700 20:23533008-23533030 GCACATGCATGTTGGAAAAATGG + Intergenic
1171771450 20:29325750-29325772 AGGTATGCATGGTGGGAAAGAGG + Intergenic
1177547232 21:22574972-22574994 AAATAAGCATTATGGGAAATGGG + Intergenic
1180948243 22:19708512-19708534 ACACATGCTTGATGGGAAATGGG + Intergenic
1182056220 22:27357266-27357288 ACATAACCATATTGGGGAATAGG - Intergenic
1183856409 22:40637644-40637666 ACATATACATGTTTTTAAATCGG - Intergenic
952288780 3:31995072-31995094 TCATATGCATCTGAGGAAATGGG + Intronic
952641618 3:35603359-35603381 ATTTATGCATGATGGGAAAGAGG + Intergenic
952690266 3:36197302-36197324 ACATATCTAGGTTGAGAAATAGG - Intergenic
953228143 3:41039652-41039674 ACATATGCATGTAGTTTAATTGG - Intergenic
953229474 3:41051881-41051903 ACATGTGTGTGTTGGGGAATTGG + Intergenic
953432132 3:42848662-42848684 ACAAAAGCATGATGAGAAATAGG + Intronic
953747705 3:45587721-45587743 ACATATGAATGTTGGGGCAGTGG - Intronic
954778042 3:53037410-53037432 CCATATGCAAATTGGGAAACAGG - Intronic
956080667 3:65552297-65552319 AGATGTTCATGTTGGGAAATTGG - Intronic
956301377 3:67775770-67775792 ACAAGGGCATGTTGGAAAATGGG - Intergenic
957188892 3:76980598-76980620 AACTATGCATTTTGGGAAGTGGG + Intronic
957836919 3:85606474-85606496 ACATATGCATATTAGAATATTGG + Intronic
959875640 3:111379445-111379467 ACATATGCAGGTTTGTAATTAGG - Intronic
960059694 3:113308476-113308498 ACATCTGCAGCTTGGGAACTTGG - Intronic
962502342 3:136008398-136008420 ACATCTGCCTGGTGGCAAATAGG + Intronic
964121152 3:153185111-153185133 AAATATACATTTGGGGAAATAGG + Intergenic
964304392 3:155325263-155325285 GCATTTTCATTTTGGGAAATGGG - Intergenic
964930429 3:162014506-162014528 ACATATGCCTTGAGGGAAATAGG - Intergenic
967518436 3:190399559-190399581 ACATATGCATCTTCTTAAATGGG + Intronic
968788534 4:2642581-2642603 AGATATGCATCTTGGGAGAGGGG + Intronic
970459149 4:16255567-16255589 AAATATATATGGTGGGAAATAGG + Intergenic
972092645 4:35307001-35307023 ACATCTACAAGCTGGGAAATGGG + Intergenic
972234033 4:37109185-37109207 ACATATGCAGGTTGTTACATGGG + Intergenic
973173896 4:47179680-47179702 AGATAGGCATGGTGGTAAATAGG + Intronic
975506110 4:75139996-75140018 ACATTGGCATATGGGGAAATTGG - Intergenic
977079373 4:92504368-92504390 ACCTAAGCAAGTTGGAAAATAGG + Intronic
977803683 4:101270638-101270660 ACATCTGCATATTGGCAAAAAGG + Intronic
981805892 4:148714780-148714802 GCATATGTGTGTTGAGAAATGGG - Intergenic
986653547 5:9988721-9988743 CCATATGGATGCTGGAAAATTGG + Intergenic
986949792 5:13069577-13069599 ACAGATGTATATTTGGAAATGGG - Intergenic
987429709 5:17817538-17817560 ACATATTCATGTTGGGATCTAGG + Intergenic
987897483 5:23966224-23966246 ACATATTGATTTTTGGAAATTGG - Intronic
988131883 5:27116983-27117005 ACATATGCATGTTGGGAAATGGG - Intronic
988165537 5:27584717-27584739 ACATGTGCATGTTGCTATATGGG + Intergenic
990621447 5:57563868-57563890 AAATATGCAAGGTAGGAAATGGG - Intergenic
991996612 5:72393940-72393962 AAATATGAATGTTGATAAATTGG - Intergenic
995192096 5:109328977-109328999 ACTAATTTATGTTGGGAAATAGG - Intergenic
995222980 5:109672016-109672038 AAATGTGAATGTCGGGAAATAGG + Intergenic
997718518 5:136059867-136059889 AGATATGCATGTAGGGAGGTAGG + Intronic
998363250 5:141609947-141609969 ACATATGCATGATAGAAAAGAGG + Intronic
999365671 5:151021827-151021849 AGTTATGCATGTTGGGAAGTTGG - Intronic
999647793 5:153736311-153736333 ACATATGCATTTTGATAAAAAGG - Intronic
1000440951 5:161262507-161262529 CCATATGCACGTAGGTAAATGGG - Intergenic
1000659333 5:163919095-163919117 AATTATGCATGTTGGCAACTTGG + Intergenic
1001082651 5:168678421-168678443 ACAAATCCCTGTTGGGAATTTGG + Intronic
1003517413 6:6828336-6828358 ACATATGCAGGTTGGTTACTGGG - Intergenic
1004074044 6:12329140-12329162 ACATATGAATGCTGTGAAAAGGG - Intergenic
1004130296 6:12913049-12913071 AAGTATGCATGCTGGGAGATAGG - Intronic
1009868171 6:69423741-69423763 ACATATGCATGTAGGGTAGGGGG + Intergenic
1012837278 6:104285562-104285584 TTATATACATGTTGGGAAATTGG + Intergenic
1013497119 6:110708512-110708534 ACATATGCAGGCTGGGAGCTGGG - Intronic
1014714183 6:124844642-124844664 CCATATGCATATTGGTAATTTGG + Intergenic
1015407207 6:132851481-132851503 ACATATTCATGTTGGTAACTTGG - Intergenic
1015738499 6:136427280-136427302 AAATGGGCCTGTTGGGAAATAGG + Intronic
1015877428 6:137837042-137837064 ATCTATGGATGTTGGGAAACAGG + Intergenic
1015931029 6:138359973-138359995 ACACATGCATGATGGGGAAAGGG + Intergenic
1017364850 6:153623239-153623261 ACATAAGCATGTTTTGAATTAGG - Intergenic
1018539036 6:164856737-164856759 ACAGATGCATGTTTGGAAGATGG - Intergenic
1021059252 7:16089998-16090020 ACAGGTGCATGTTGGGGACTTGG + Intergenic
1022615478 7:31925915-31925937 ACATATGCATACATGGAAATCGG - Intronic
1026174195 7:67981617-67981639 ACATATGAATTTTGGGAATTCGG + Intergenic
1027637924 7:80699436-80699458 ACATACGCATGTTACTAAATGGG + Intergenic
1027957209 7:84895913-84895935 ACAACTGCATCTTGTGAAATAGG - Intergenic
1027995138 7:85416327-85416349 TCATATTCATGTTGAAAAATTGG + Intergenic
1030803361 7:113882138-113882160 ACAAATGATTGTTGGGATATAGG + Exonic
1032606426 7:133359538-133359560 AAATTTTCATGTTGGGAAACAGG - Intronic
1033465513 7:141585599-141585621 AAATATTCTTTTTGGGAAATAGG + Intronic
1036212112 8:6850672-6850694 GCATATGTATGGTGGGAAGTGGG - Intergenic
1037435881 8:18862602-18862624 ACATTTTCATGTTGTGAAATTGG - Intronic
1039309368 8:36298904-36298926 ACATGTGCATGTTTGTTAATAGG + Intergenic
1040366100 8:46718243-46718265 ACATGTGCATGTTTGTATATAGG + Intergenic
1041129007 8:54676551-54676573 ACATATGTATGTTGGTGAGTAGG - Intergenic
1041501555 8:58544255-58544277 AAATAGCCATGTTGGGAAAAAGG - Intergenic
1041737900 8:61131240-61131262 ACATATGCATTTTAGGAATGAGG + Intronic
1042067426 8:64893511-64893533 GTATATGCATGCTGGGAGATGGG - Intergenic
1042290550 8:67166690-67166712 AAATATGCATGTTTAGAAGTTGG - Intronic
1042627416 8:70773518-70773540 ACATGTACATTTTGGGAAAGGGG + Intronic
1043190719 8:77219107-77219129 ACATATGCATGTTATTATATAGG - Intergenic
1043487434 8:80711809-80711831 AAATATGCATGTGGGAAAAGGGG + Intronic
1044014084 8:87029460-87029482 ACATAGACACATTGGGAAATGGG + Intronic
1044960014 8:97521429-97521451 ACATATGCAGGTTGTTACATAGG - Intergenic
1046290749 8:112156728-112156750 ACATGTGCATGTTGTTATATAGG - Intergenic
1050378085 9:4993888-4993910 ACATATGCATCTTTGGAATGTGG - Intronic
1050622322 9:7467353-7467375 ACATCTGCAATTTGGGAAATGGG - Intergenic
1050780079 9:9322598-9322620 ACATATGCATGTCAGGATCTCGG + Intronic
1050810766 9:9743959-9743981 ACATATACAAGTTAGGATATAGG - Intronic
1050830433 9:10004416-10004438 ACATATACATTTTGGGGATTGGG - Intronic
1052622653 9:30934105-30934127 AGAAATACATGTTGTGAAATTGG - Intergenic
1060330560 9:122665308-122665330 ACTTCTGCATGTTGTGAAATGGG + Intergenic
1062621613 9:137424906-137424928 GCATATGCATGTTAGGAATATGG + Intronic
1185657779 X:1699776-1699798 ACATTGGCATGTAAGGAAATTGG - Intergenic
1187265530 X:17728942-17728964 TGATATGCAAGTTGGGAAATAGG + Intronic
1188360418 X:29246286-29246308 AAGTTTGCATGTTGGTAAATAGG - Intronic
1188603304 X:31996122-31996144 ACATAGGCATGGAGAGAAATTGG + Intronic
1188759902 X:34014311-34014333 ATAGATGCAGGCTGGGAAATAGG + Intergenic
1189094032 X:38118983-38119005 ACATATATATGTTGAGAGATAGG + Intronic
1191090356 X:56614493-56614515 AGATATCCATATTGGAAAATTGG + Intergenic
1192324273 X:70118971-70118993 ACATATGTATGTAATGAAATAGG - Intergenic
1192368653 X:70495904-70495926 TCAGATGCAGGTTGGGAAAAAGG - Intronic
1193055953 X:77151125-77151147 ATATGTGCTTGTTGGCAAATAGG - Intergenic
1193247097 X:79242172-79242194 ACAAATGCAGGTGGGGAAAGAGG - Intergenic
1193653804 X:84172473-84172495 ACATAAGGATGTGGAGAAATTGG + Intronic