ID: 988134163

View in Genome Browser
Species Human (GRCh38)
Location 5:27147741-27147763
Sequence TGATGCTATTAGAATGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988134162_988134163 -5 Left 988134162 5:27147723-27147745 CCAGTAATGTAATTAGAATGATG No data
Right 988134163 5:27147741-27147763 TGATGCTATTAGAATGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988134163 Original CRISPR TGATGCTATTAGAATGATAT AGG Intergenic
No off target data available for this crispr