ID: 988136110

View in Genome Browser
Species Human (GRCh38)
Location 5:27173872-27173894
Sequence AAACCCTGCTTCACAAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988136110_988136111 16 Left 988136110 5:27173872-27173894 CCAATCTTTGTGAAGCAGGGTTT No data
Right 988136111 5:27173911-27173933 CTAAAACGAGATTACAGCATAGG No data
988136110_988136113 20 Left 988136110 5:27173872-27173894 CCAATCTTTGTGAAGCAGGGTTT No data
Right 988136113 5:27173915-27173937 AACGAGATTACAGCATAGGAGGG No data
988136110_988136112 19 Left 988136110 5:27173872-27173894 CCAATCTTTGTGAAGCAGGGTTT No data
Right 988136112 5:27173914-27173936 AAACGAGATTACAGCATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988136110 Original CRISPR AAACCCTGCTTCACAAAGAT TGG (reversed) Intergenic