ID: 988136717

View in Genome Browser
Species Human (GRCh38)
Location 5:27181621-27181643
Sequence TTGAGTTACAACTTACAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988136717_988136721 -9 Left 988136717 5:27181621-27181643 CCCACCTGTAAGTTGTAACTCAA No data
Right 988136721 5:27181635-27181657 GTAACTCAAATGATACGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988136717 Original CRISPR TTGAGTTACAACTTACAGGT GGG (reversed) Intergenic
No off target data available for this crispr