ID: 988138796

View in Genome Browser
Species Human (GRCh38)
Location 5:27209135-27209157
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988138796_988138798 -8 Left 988138796 5:27209135-27209157 CCTTTTATCTAATGCTGTTAGAG No data
Right 988138798 5:27209150-27209172 TGTTAGAGCCCATAGTGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988138796 Original CRISPR CTCTAACAGCATTAGATAAA AGG (reversed) Intergenic
No off target data available for this crispr