ID: 988146784

View in Genome Browser
Species Human (GRCh38)
Location 5:27319500-27319522
Sequence GTTGTACTTTTTGATCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988146784_988146790 17 Left 988146784 5:27319500-27319522 CCCAAGAGATCAAAAAGTACAAC No data
Right 988146790 5:27319540-27319562 AATTCTTTCTGCCCTAAGGGGGG No data
988146784_988146787 14 Left 988146784 5:27319500-27319522 CCCAAGAGATCAAAAAGTACAAC No data
Right 988146787 5:27319537-27319559 AATAATTCTTTCTGCCCTAAGGG No data
988146784_988146789 16 Left 988146784 5:27319500-27319522 CCCAAGAGATCAAAAAGTACAAC No data
Right 988146789 5:27319539-27319561 TAATTCTTTCTGCCCTAAGGGGG No data
988146784_988146788 15 Left 988146784 5:27319500-27319522 CCCAAGAGATCAAAAAGTACAAC No data
Right 988146788 5:27319538-27319560 ATAATTCTTTCTGCCCTAAGGGG No data
988146784_988146786 13 Left 988146784 5:27319500-27319522 CCCAAGAGATCAAAAAGTACAAC No data
Right 988146786 5:27319536-27319558 CAATAATTCTTTCTGCCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988146784 Original CRISPR GTTGTACTTTTTGATCTCTT GGG (reversed) Intergenic