ID: 988146785

View in Genome Browser
Species Human (GRCh38)
Location 5:27319501-27319523
Sequence TGTTGTACTTTTTGATCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988146785_988146788 14 Left 988146785 5:27319501-27319523 CCAAGAGATCAAAAAGTACAACA No data
Right 988146788 5:27319538-27319560 ATAATTCTTTCTGCCCTAAGGGG No data
988146785_988146789 15 Left 988146785 5:27319501-27319523 CCAAGAGATCAAAAAGTACAACA No data
Right 988146789 5:27319539-27319561 TAATTCTTTCTGCCCTAAGGGGG No data
988146785_988146790 16 Left 988146785 5:27319501-27319523 CCAAGAGATCAAAAAGTACAACA No data
Right 988146790 5:27319540-27319562 AATTCTTTCTGCCCTAAGGGGGG No data
988146785_988146787 13 Left 988146785 5:27319501-27319523 CCAAGAGATCAAAAAGTACAACA No data
Right 988146787 5:27319537-27319559 AATAATTCTTTCTGCCCTAAGGG No data
988146785_988146786 12 Left 988146785 5:27319501-27319523 CCAAGAGATCAAAAAGTACAACA No data
Right 988146786 5:27319536-27319558 CAATAATTCTTTCTGCCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988146785 Original CRISPR TGTTGTACTTTTTGATCTCT TGG (reversed) Intergenic
No off target data available for this crispr