ID: 988146786

View in Genome Browser
Species Human (GRCh38)
Location 5:27319536-27319558
Sequence CAATAATTCTTTCTGCCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988146784_988146786 13 Left 988146784 5:27319500-27319522 CCCAAGAGATCAAAAAGTACAAC No data
Right 988146786 5:27319536-27319558 CAATAATTCTTTCTGCCCTAAGG No data
988146785_988146786 12 Left 988146785 5:27319501-27319523 CCAAGAGATCAAAAAGTACAACA No data
Right 988146786 5:27319536-27319558 CAATAATTCTTTCTGCCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988146786 Original CRISPR CAATAATTCTTTCTGCCCTA AGG Intergenic
No off target data available for this crispr