ID: 988146788

View in Genome Browser
Species Human (GRCh38)
Location 5:27319538-27319560
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988146785_988146788 14 Left 988146785 5:27319501-27319523 CCAAGAGATCAAAAAGTACAACA No data
Right 988146788 5:27319538-27319560 ATAATTCTTTCTGCCCTAAGGGG No data
988146784_988146788 15 Left 988146784 5:27319500-27319522 CCCAAGAGATCAAAAAGTACAAC No data
Right 988146788 5:27319538-27319560 ATAATTCTTTCTGCCCTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr