ID: 988160824

View in Genome Browser
Species Human (GRCh38)
Location 5:27516862-27516884
Sequence GACAGATCTAGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988160824_988160827 16 Left 988160824 5:27516862-27516884 CCAGTAACAGGCCTAGATCTGTC No data
Right 988160827 5:27516901-27516923 TTTATCTAAAGAAGATAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988160824 Original CRISPR GACAGATCTAGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr