ID: 988163099

View in Genome Browser
Species Human (GRCh38)
Location 5:27546896-27546918
Sequence AAAGCTTGGTGCACCTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988163099_988163105 5 Left 988163099 5:27546896-27546918 CCCATAAAGGTGCACCAAGCTTT No data
Right 988163105 5:27546924-27546946 GGAACCTAGTGTTGAACTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988163099 Original CRISPR AAAGCTTGGTGCACCTTTAT GGG (reversed) Intergenic
No off target data available for this crispr