ID: 988164526

View in Genome Browser
Species Human (GRCh38)
Location 5:27568172-27568194
Sequence CACTGGCATGTACTATGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988164526_988164531 17 Left 988164526 5:27568172-27568194 CCCCAACATAGTACATGCCAGTG No data
Right 988164531 5:27568212-27568234 TAGTTATATTTCTGTCAATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988164526 Original CRISPR CACTGGCATGTACTATGTTG GGG (reversed) Intergenic
No off target data available for this crispr