ID: 988166028

View in Genome Browser
Species Human (GRCh38)
Location 5:27590646-27590668
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988166028_988166036 20 Left 988166028 5:27590646-27590668 CCAACGTGCCGCCAGGTCACTGG No data
Right 988166036 5:27590689-27590711 AATGCACTCAGGCTGAGCTGGGG No data
988166028_988166033 9 Left 988166028 5:27590646-27590668 CCAACGTGCCGCCAGGTCACTGG No data
Right 988166033 5:27590678-27590700 TTAGATAGAGCAATGCACTCAGG No data
988166028_988166035 19 Left 988166028 5:27590646-27590668 CCAACGTGCCGCCAGGTCACTGG No data
Right 988166035 5:27590688-27590710 CAATGCACTCAGGCTGAGCTGGG No data
988166028_988166034 18 Left 988166028 5:27590646-27590668 CCAACGTGCCGCCAGGTCACTGG No data
Right 988166034 5:27590687-27590709 GCAATGCACTCAGGCTGAGCTGG No data
988166028_988166037 23 Left 988166028 5:27590646-27590668 CCAACGTGCCGCCAGGTCACTGG No data
Right 988166037 5:27590692-27590714 GCACTCAGGCTGAGCTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988166028 Original CRISPR CCAGTGACCTGGCGGCACGT TGG (reversed) Intergenic
No off target data available for this crispr