ID: 988166032

View in Genome Browser
Species Human (GRCh38)
Location 5:27590657-27590679
Sequence AAAGTACTTTCCCAGTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988166032_988166033 -2 Left 988166032 5:27590657-27590679 CCAGGTCACTGGGAAAGTACTTT No data
Right 988166033 5:27590678-27590700 TTAGATAGAGCAATGCACTCAGG No data
988166032_988166035 8 Left 988166032 5:27590657-27590679 CCAGGTCACTGGGAAAGTACTTT No data
Right 988166035 5:27590688-27590710 CAATGCACTCAGGCTGAGCTGGG No data
988166032_988166036 9 Left 988166032 5:27590657-27590679 CCAGGTCACTGGGAAAGTACTTT No data
Right 988166036 5:27590689-27590711 AATGCACTCAGGCTGAGCTGGGG No data
988166032_988166034 7 Left 988166032 5:27590657-27590679 CCAGGTCACTGGGAAAGTACTTT No data
Right 988166034 5:27590687-27590709 GCAATGCACTCAGGCTGAGCTGG No data
988166032_988166037 12 Left 988166032 5:27590657-27590679 CCAGGTCACTGGGAAAGTACTTT No data
Right 988166037 5:27590692-27590714 GCACTCAGGCTGAGCTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988166032 Original CRISPR AAAGTACTTTCCCAGTGACC TGG (reversed) Intergenic
No off target data available for this crispr