ID: 988166035

View in Genome Browser
Species Human (GRCh38)
Location 5:27590688-27590710
Sequence CAATGCACTCAGGCTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988166032_988166035 8 Left 988166032 5:27590657-27590679 CCAGGTCACTGGGAAAGTACTTT No data
Right 988166035 5:27590688-27590710 CAATGCACTCAGGCTGAGCTGGG No data
988166028_988166035 19 Left 988166028 5:27590646-27590668 CCAACGTGCCGCCAGGTCACTGG No data
Right 988166035 5:27590688-27590710 CAATGCACTCAGGCTGAGCTGGG No data
988166031_988166035 11 Left 988166031 5:27590654-27590676 CCGCCAGGTCACTGGGAAAGTAC No data
Right 988166035 5:27590688-27590710 CAATGCACTCAGGCTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988166035 Original CRISPR CAATGCACTCAGGCTGAGCT GGG Intergenic
No off target data available for this crispr