ID: 988166300

View in Genome Browser
Species Human (GRCh38)
Location 5:27594602-27594624
Sequence ATTCCCAGAAGTGCTAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988166299_988166300 22 Left 988166299 5:27594557-27594579 CCAGTCTTTGCTACTATTTCTAC No data
Right 988166300 5:27594602-27594624 ATTCCCAGAAGTGCTAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988166300 Original CRISPR ATTCCCAGAAGTGCTAATAT TGG Intergenic
No off target data available for this crispr