ID: 988169198

View in Genome Browser
Species Human (GRCh38)
Location 5:27632819-27632841
Sequence GGCCAGTTACTGGGCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988169198_988169205 25 Left 988169198 5:27632819-27632841 CCACCAAAGCCCAGTAACTGGCC No data
Right 988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG No data
988169198_988169206 26 Left 988169198 5:27632819-27632841 CCACCAAAGCCCAGTAACTGGCC No data
Right 988169206 5:27632868-27632890 GCGATCTGCAGAAGATGGCAGGG No data
988169198_988169202 -3 Left 988169198 5:27632819-27632841 CCACCAAAGCCCAGTAACTGGCC No data
Right 988169202 5:27632839-27632861 GCCAAAAGCTGACTTTCAAAAGG No data
988169198_988169204 21 Left 988169198 5:27632819-27632841 CCACCAAAGCCCAGTAACTGGCC No data
Right 988169204 5:27632863-27632885 GAGTAGCGATCTGCAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988169198 Original CRISPR GGCCAGTTACTGGGCTTTGG TGG (reversed) Intergenic
No off target data available for this crispr