ID: 988169200

View in Genome Browser
Species Human (GRCh38)
Location 5:27632828-27632850
Sequence TCAGCTTTTGGCCAGTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988169200_988169206 17 Left 988169200 5:27632828-27632850 CCCAGTAACTGGCCAAAAGCTGA No data
Right 988169206 5:27632868-27632890 GCGATCTGCAGAAGATGGCAGGG No data
988169200_988169205 16 Left 988169200 5:27632828-27632850 CCCAGTAACTGGCCAAAAGCTGA No data
Right 988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG No data
988169200_988169204 12 Left 988169200 5:27632828-27632850 CCCAGTAACTGGCCAAAAGCTGA No data
Right 988169204 5:27632863-27632885 GAGTAGCGATCTGCAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988169200 Original CRISPR TCAGCTTTTGGCCAGTTACT GGG (reversed) Intergenic
No off target data available for this crispr