ID: 988169201

View in Genome Browser
Species Human (GRCh38)
Location 5:27632829-27632851
Sequence GTCAGCTTTTGGCCAGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988169201_988169204 11 Left 988169201 5:27632829-27632851 CCAGTAACTGGCCAAAAGCTGAC No data
Right 988169204 5:27632863-27632885 GAGTAGCGATCTGCAGAAGATGG No data
988169201_988169205 15 Left 988169201 5:27632829-27632851 CCAGTAACTGGCCAAAAGCTGAC No data
Right 988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG No data
988169201_988169206 16 Left 988169201 5:27632829-27632851 CCAGTAACTGGCCAAAAGCTGAC No data
Right 988169206 5:27632868-27632890 GCGATCTGCAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988169201 Original CRISPR GTCAGCTTTTGGCCAGTTAC TGG (reversed) Intergenic
No off target data available for this crispr