ID: 988169203

View in Genome Browser
Species Human (GRCh38)
Location 5:27632840-27632862
Sequence TCCTTTTGAAAGTCAGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988169203_988169206 5 Left 988169203 5:27632840-27632862 CCAAAAGCTGACTTTCAAAAGGA No data
Right 988169206 5:27632868-27632890 GCGATCTGCAGAAGATGGCAGGG No data
988169203_988169207 27 Left 988169203 5:27632840-27632862 CCAAAAGCTGACTTTCAAAAGGA No data
Right 988169207 5:27632890-27632912 GTCTTGCTCCTAAATCCTAGAGG No data
988169203_988169204 0 Left 988169203 5:27632840-27632862 CCAAAAGCTGACTTTCAAAAGGA No data
Right 988169204 5:27632863-27632885 GAGTAGCGATCTGCAGAAGATGG No data
988169203_988169205 4 Left 988169203 5:27632840-27632862 CCAAAAGCTGACTTTCAAAAGGA No data
Right 988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988169203 Original CRISPR TCCTTTTGAAAGTCAGCTTT TGG (reversed) Intergenic
No off target data available for this crispr