ID: 988169205

View in Genome Browser
Species Human (GRCh38)
Location 5:27632867-27632889
Sequence AGCGATCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988169200_988169205 16 Left 988169200 5:27632828-27632850 CCCAGTAACTGGCCAAAAGCTGA No data
Right 988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG No data
988169199_988169205 22 Left 988169199 5:27632822-27632844 CCAAAGCCCAGTAACTGGCCAAA No data
Right 988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG No data
988169198_988169205 25 Left 988169198 5:27632819-27632841 CCACCAAAGCCCAGTAACTGGCC No data
Right 988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG No data
988169201_988169205 15 Left 988169201 5:27632829-27632851 CCAGTAACTGGCCAAAAGCTGAC No data
Right 988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG No data
988169203_988169205 4 Left 988169203 5:27632840-27632862 CCAAAAGCTGACTTTCAAAAGGA No data
Right 988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988169205 Original CRISPR AGCGATCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr