ID: 988174954

View in Genome Browser
Species Human (GRCh38)
Location 5:27710875-27710897
Sequence TCTTATATGGTCATGGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988174954_988174957 3 Left 988174954 5:27710875-27710897 CCATGAACCATGACCATATAAGA No data
Right 988174957 5:27710901-27710923 CAAACTTAATTGATAAATGTTGG 0: 2
1: 4
2: 4
3: 23
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988174954 Original CRISPR TCTTATATGGTCATGGTTCA TGG (reversed) Intergenic
No off target data available for this crispr