ID: 988174957

View in Genome Browser
Species Human (GRCh38)
Location 5:27710901-27710923
Sequence CAAACTTAATTGATAAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 2, 1: 4, 2: 4, 3: 23, 4: 335}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988174954_988174957 3 Left 988174954 5:27710875-27710897 CCATGAACCATGACCATATAAGA No data
Right 988174957 5:27710901-27710923 CAAACTTAATTGATAAATGTTGG 0: 2
1: 4
2: 4
3: 23
4: 335
988174955_988174957 -4 Left 988174955 5:27710882-27710904 CCATGACCATATAAGACAGCAAA No data
Right 988174957 5:27710901-27710923 CAAACTTAATTGATAAATGTTGG 0: 2
1: 4
2: 4
3: 23
4: 335
988174956_988174957 -10 Left 988174956 5:27710888-27710910 CCATATAAGACAGCAAACTTAAT 0: 31
1: 112
2: 270
3: 460
4: 703
Right 988174957 5:27710901-27710923 CAAACTTAATTGATAAATGTTGG 0: 2
1: 4
2: 4
3: 23
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988174957 Original CRISPR CAAACTTAATTGATAAATGT TGG Intergenic
902847068 1:19119790-19119812 CAAACTTAACCCATAATTGTGGG - Intronic
905130121 1:35748339-35748361 CAAACTTTATTTAGCAATGTGGG + Intronic
907019447 1:51052150-51052172 TGAACTTAATTGATAAGTATTGG - Intergenic
907097502 1:51795112-51795134 CAAACTTAATTGTTCAGTGTTGG + Intronic
908429629 1:64043192-64043214 GAAAATTAAGTAATAAATGTTGG + Intronic
908725222 1:67168617-67168639 CAAACTTTACTGAAAAAAGTAGG + Intronic
909317585 1:74243397-74243419 GAAACTTAAATGATCAATTTGGG + Intronic
909908089 1:81223593-81223615 CTAAATTAAGTGTTAAATGTTGG + Intergenic
910060388 1:83084820-83084842 AAAACTTTATTGAGAAGTGTAGG + Intergenic
910913725 1:92265812-92265834 AAAACTTTATTGATAAAATTGGG - Intronic
913003725 1:114607483-114607505 GAAATTTGATTGTTAAATGTTGG + Intronic
916351692 1:163857122-163857144 CAAACATAATTGATAGTAGTGGG + Intergenic
917516052 1:175709450-175709472 GAAACCTAATTAATAAATGGGGG - Intronic
917587517 1:176442755-176442777 CAAATTTCATGGATAAATTTAGG - Intergenic
919267439 1:195288880-195288902 CATACTGAATTGATAAATGGTGG + Intergenic
919296840 1:195712393-195712415 CAACTGTAATTAATAAATGTTGG + Intergenic
920415074 1:205793718-205793740 TAAACTTAAATGAAAAATGCAGG + Intronic
921259535 1:213373443-213373465 CATACATAACTGAAAAATGTAGG - Intergenic
921588467 1:216976134-216976156 CAAACTTTTTGGATTAATGTAGG - Intronic
921626440 1:217382180-217382202 CAAACTTATTTTATGAATCTGGG - Intergenic
921974326 1:221185271-221185293 AAAAATTTATAGATAAATGTTGG - Intergenic
922279645 1:224111576-224111598 CAAATTTAATCAATACATGTAGG - Intergenic
922971191 1:229740673-229740695 TAAATTTAACTGATAAATGAAGG + Intergenic
924733359 1:246732332-246732354 GAAACTGAATTGATAAAACTTGG + Intronic
1064724863 10:18268842-18268864 CAAAAGTAATTCATAAATGGAGG + Intronic
1065190869 10:23207577-23207599 CTAATTTAATTGAGAAATGTTGG - Intronic
1067548298 10:47213065-47213087 TAAACTTATTTGATAAATCAGGG + Intergenic
1068842691 10:61632927-61632949 CAAACTTAATGCAATAATGTAGG - Intergenic
1069149104 10:64933051-64933073 CAAACATAAATAATAAATGGAGG - Intergenic
1071759605 10:88585919-88585941 CAAATGTAAGTGATAACTGTAGG - Intergenic
1071840408 10:89464802-89464824 CAAACCTAAGTGATGTATGTGGG - Intronic
1072187637 10:93056571-93056593 CAGATTTAATTAATAAAGGTTGG - Intronic
1072750867 10:97977700-97977722 GAAACATAACTGAGAAATGTTGG + Intronic
1075746387 10:124730985-124731007 AAAACTTTATTTACAAATGTAGG + Intronic
1078675196 11:13405526-13405548 AAAACTTAATTTATAAAAATAGG + Intronic
1078831544 11:14981832-14981854 CAAACTAAATTGATATAGTTTGG - Intronic
1079776507 11:24537029-24537051 CAAAATTAACTAACAAATGTGGG - Intronic
1081206939 11:40286772-40286794 CAAGGTTAATTGACAAATTTAGG + Intronic
1081517762 11:43849995-43850017 CAAAGATCCTTGATAAATGTTGG - Intronic
1081951287 11:47045714-47045736 AAAATTGATTTGATAAATGTAGG + Intronic
1083973204 11:66095900-66095922 CAAACTTATTGGGAAAATGTGGG - Intronic
1084300967 11:68252191-68252213 GAAACTGAGGTGATAAATGTGGG + Intergenic
1087358363 11:97124049-97124071 CAAAAATTATTGATAAATATGGG - Intergenic
1088085325 11:105971381-105971403 AAAACCTAATTGAAAAAGGTGGG - Intronic
1088418268 11:109613648-109613670 CAAACTTGTTTTATAAATCTAGG - Intergenic
1089336436 11:117727112-117727134 CATCCTTCATTTATAAATGTGGG - Intronic
1090040640 11:123287964-123287986 CAAACTCAATATATAAAAGTAGG - Intergenic
1090557108 11:127888061-127888083 CAAACTTATTTGATAAATGTTGG - Intergenic
1092006761 12:5076714-5076736 CAAACATATCTGTTAAATGTTGG + Intergenic
1093137986 12:15474721-15474743 GAAACTGATCTGATAAATGTAGG - Intronic
1093161391 12:15751416-15751438 CAAAATGAATGAATAAATGTTGG - Intronic
1093258953 12:16910141-16910163 ATAAATTAATTGAGAAATGTTGG + Intergenic
1093333078 12:17867040-17867062 AAAAATTTATTGATAAATTTTGG - Intergenic
1093438815 12:19169296-19169318 CTAACTTAATTTATCTATGTTGG - Intronic
1093568455 12:20636607-20636629 TAAACTTAATTAATAATAGTAGG + Intronic
1093624855 12:21332897-21332919 CAAAAATAATTGATAAATTTTGG - Intronic
1094054165 12:26251611-26251633 CAAACTTAATTGATTAGTAACGG - Intronic
1095183853 12:39178464-39178486 CAACCTTGAAAGATAAATGTGGG - Intergenic
1096762791 12:53856692-53856714 CAAACATAAATTATAAATTTTGG - Intergenic
1097471195 12:59994471-59994493 CAAAAGTAATTTATACATGTGGG - Intergenic
1097583905 12:61492345-61492367 TATAATTAATTGATATATGTTGG - Intergenic
1098657294 12:73048605-73048627 CATACTTACTTGAGAAAAGTAGG + Intergenic
1098685644 12:73416506-73416528 TAAACTTAATTGGTGATTGTAGG - Intergenic
1098717088 12:73843311-73843333 CAAACTTTATTAATAAATTCAGG - Intergenic
1098936720 12:76488663-76488685 GTAACTGAACTGATAAATGTAGG + Intronic
1099098238 12:78402855-78402877 CAAACTTAATTAAGGAAAGTTGG - Intergenic
1099241157 12:80140897-80140919 TACACTTATTTCATAAATGTGGG - Intergenic
1099273228 12:80540728-80540750 TAAAAATAAATGATAAATGTGGG + Intronic
1099484941 12:83217696-83217718 CAAGATTAATTGCTAAATGATGG + Intergenic
1100183525 12:92111581-92111603 CATACTTAATTTAAAAATGAAGG + Intronic
1101352250 12:103942065-103942087 GAAACTTCATTATTAAATGTTGG - Intronic
1104346887 12:128008054-128008076 CAATGTTGATTGAAAAATGTTGG + Intergenic
1105669677 13:22598856-22598878 CAAACTTAATGAGCAAATGTAGG - Intergenic
1105879802 13:24594170-24594192 CAAAAGTACTTGATAAATATAGG + Intergenic
1105920046 13:24954948-24954970 CAAAAGTACTTGATAAATATAGG - Intergenic
1106220090 13:27739575-27739597 AAAAGTTAAGTGATATATGTCGG + Intergenic
1106633724 13:31504964-31504986 CAAACATTATTGATAATTGATGG + Intergenic
1106800882 13:33254879-33254901 CAGACTTAAAGGATGAATGTGGG - Intronic
1106981642 13:35290987-35291009 CAAAGATAAATGATAATTGTTGG + Intronic
1107085093 13:36418856-36418878 TAAAGTTAAATGATAAAAGTTGG + Intergenic
1107309146 13:39058147-39058169 CATACTTAATGGGCAAATGTTGG - Intergenic
1107485827 13:40826675-40826697 CAAAAGTACTTGATAAATATTGG - Intergenic
1107865587 13:44700229-44700251 CCAACTTAATTGAAAAATAAAGG + Intergenic
1108660704 13:52582995-52583017 CAAAAGTACTTGATAAATATAGG + Intergenic
1108834281 13:54521624-54521646 AACACGTAATTGATAATTGTAGG - Intergenic
1108912231 13:55569474-55569496 AAAACTTAATTGCTATTTGTTGG - Intergenic
1109033440 13:57223996-57224018 CAAACTTATTTTTTAACTGTTGG + Intergenic
1109812252 13:67528593-67528615 CATATTTAATTGGGAAATGTGGG + Intergenic
1110070439 13:71169504-71169526 CAATCTTAAATAAAAAATGTTGG + Intergenic
1112706910 13:102080650-102080672 CAACCTAAAAGGATAAATGTTGG + Intronic
1112853059 13:103730791-103730813 CAAATTGAATTGTTAAATATGGG + Intergenic
1113283500 13:108817795-108817817 CATACTCAATTGATAAACGTTGG - Intronic
1114348740 14:21826304-21826326 CAAAGTTAATTGCTACATCTGGG + Intergenic
1114882848 14:26808013-26808035 AAAAGTTAATAGATAAATGTGGG - Intergenic
1114950056 14:27739067-27739089 TGAAGTTAATTGATAAATGCTGG + Intergenic
1116367980 14:44092587-44092609 CAAACTTTATTTATGAAAGTAGG + Intergenic
1116601678 14:46933264-46933286 CAAAATTAATTAATAAATATAGG + Intronic
1116637929 14:47421325-47421347 CAAACTAAATTGCAAATTGTGGG + Intronic
1116748870 14:48856053-48856075 AAAAGTTAATTGATATAGGTTGG + Intergenic
1118197693 14:63642839-63642861 TACACATAATTGCTAAATGTAGG - Intergenic
1119063310 14:71499116-71499138 CAAAATGACTTGATGAATGTGGG - Intronic
1119877160 14:78070778-78070800 CACACTTATTTGATAAAGGAGGG + Intergenic
1124611136 15:31209725-31209747 CAATCTTAATTGATCACTTTTGG + Intergenic
1124911275 15:33923617-33923639 AAAACTTTATTTATAAAAGTTGG + Intronic
1126310716 15:47313540-47313562 CAAACATAATTGCTAAAACTTGG - Intronic
1128826219 15:70719854-70719876 AAATCTTACTGGATAAATGTAGG - Intronic
1129762929 15:78141820-78141842 CAAACTTACTTGTTATAAGTAGG + Intronic
1130828749 15:87577760-87577782 CAAACGTAAGTGATAAAACTAGG + Intergenic
1131032510 15:89198018-89198040 CAAACTTGCCTGATAAATGAGGG + Exonic
1132156203 15:99496844-99496866 CAAACACAATTGATCTATGTTGG - Intergenic
1133867016 16:9653627-9653649 CAAAATTAATTAATAATTGTTGG + Intergenic
1134589280 16:15438868-15438890 CACACTTAATAAATAAATGGAGG - Intronic
1136370729 16:29834368-29834390 CAAATACAATTGACAAATGTAGG + Intronic
1136854699 16:33645330-33645352 CAAACTTGACTGCTAAATATTGG + Intergenic
1137838763 16:51620573-51620595 CCACATTAATTGGTAAATGTTGG - Intergenic
1139079728 16:63501652-63501674 CAAACTAAAATGTTAAATGTGGG - Intergenic
1139109082 16:63866723-63866745 GCAACTTCACTGATAAATGTTGG + Intergenic
1139951189 16:70671549-70671571 GAATCTCAATTAATAAATGTAGG + Intronic
1141016421 16:80454963-80454985 AAAACTTTATTTATAAATGCAGG + Intergenic
1203116274 16_KI270728v1_random:1493803-1493825 CAAACTTGACTGCTAAATATTGG + Intergenic
1144615875 17:16772028-16772050 TAAATTTAATTCATAAATTTTGG - Intronic
1145135385 17:20400572-20400594 TAAATTTAATTCATAAATTTTGG - Intergenic
1145295208 17:21585345-21585367 CAAAATTAATTTTTAAATTTTGG + Intergenic
1145368292 17:22284304-22284326 CAAAATTAATTTTTAAATTTTGG - Intergenic
1148057318 17:44808130-44808152 TAAATTTATTTGCTAAATGTGGG - Intronic
1148940199 17:51201979-51202001 CAAACCTAATTTACAAATGAGGG + Intronic
1149241460 17:54655173-54655195 CAAAATTAAATGAAAAATGCTGG - Intergenic
1154155913 18:11944011-11944033 CAGACTTGAAGGATAAATGTGGG + Intergenic
1154422653 18:14248273-14248295 TAAATTTAATTAATAAATTTTGG - Intergenic
1155827431 18:30465478-30465500 CAAGCTTAATTGATCAATGTTGG - Intergenic
1156001062 18:32384531-32384553 CAAACTAAGTTGTTAAATCTAGG - Intronic
1156135036 18:34027353-34027375 AAAAATTAAGTGATAATTGTTGG + Intronic
1156999445 18:43507636-43507658 AAAACTTATTTTATAAATGTGGG + Intergenic
1158760348 18:60378109-60378131 CAAACTTAATTCATATATCAGGG + Intergenic
1159126045 18:64225982-64226004 CAAACTTGAGAGATAGATGTGGG + Intergenic
1160165950 18:76512684-76512706 GAAACTTAGTTGATAAAGCTGGG - Intergenic
1160430533 18:78808785-78808807 CAAACTTAATTGCCAATTATGGG - Intergenic
1160450536 18:78961215-78961237 CAAACTTGCTGGATAAATGCTGG - Intergenic
1164121753 19:22272065-22272087 CAAATATAATTGATAATTGAAGG - Intergenic
925508486 2:4597244-4597266 CCAACATAATTGATATATTTGGG - Intergenic
925783701 2:7407643-7407665 CAAGCTTAAATGAGAAATGCAGG - Intergenic
926417363 2:12662975-12662997 CAAAATTAATTCATTGATGTGGG + Intergenic
927006504 2:18855279-18855301 CAAACTAGTTTGGTAAATGTGGG - Intergenic
927102797 2:19800775-19800797 CAAATTTAAAAAATAAATGTTGG - Intergenic
928045869 2:27931090-27931112 CAAGATTAAATGAGAAATGTTGG + Intronic
928787856 2:34911804-34911826 CTAACTTTATTTTTAAATGTTGG + Intergenic
929104806 2:38354371-38354393 AAAAGATAATTGATCAATGTGGG + Intronic
929403532 2:41613160-41613182 AAAACTTTATTGATAAAAATAGG + Intergenic
931060534 2:58523909-58523931 CAAACTAAACTGTTACATGTGGG + Intergenic
931331094 2:61284774-61284796 TAAACTTAATAGAAAAATTTGGG - Intronic
933001004 2:76922920-76922942 GAAACTAAAATGATAAATTTTGG + Intronic
933407743 2:81882536-81882558 TAAACTGAATTAACAAATGTTGG + Intergenic
934061823 2:88301696-88301718 TAAACTTAGTTGATAAATTAGGG + Intergenic
936778450 2:116002872-116002894 AAAAGTCAATTAATAAATGTTGG - Intergenic
938424117 2:131170242-131170264 TAAACTTAGTTGATAAATCATGG + Intronic
938746596 2:134284310-134284332 AAAACTTTATTTATAAATTTAGG - Intronic
939008016 2:136811269-136811291 CAAACTCACTAGATAGATGTAGG + Intronic
939198800 2:139007943-139007965 CATACAGAATTGATAAATTTTGG - Intergenic
939277637 2:140020429-140020451 TAAACTTAATTTATAATTTTAGG - Intergenic
940151560 2:150608091-150608113 CACACTTAATTGTTAGAAGTGGG - Intergenic
940205190 2:151194674-151194696 CAAACTGAATAAATAAAGGTTGG - Intergenic
940459826 2:153950666-153950688 AAAAGTTGATTAATAAATGTTGG + Intronic
940462405 2:153982165-153982187 TTAACTAAAATGATAAATGTTGG - Intronic
941408274 2:165119346-165119368 ACAATTTAATTTATAAATGTAGG - Intronic
941975305 2:171397886-171397908 CAAATGTAATTAATAAATTTAGG - Intronic
942258980 2:174138385-174138407 CAAACTTAGTCGATAAATGTTGG - Intronic
942977681 2:182038502-182038524 CAAACTGAAAAGATATATGTAGG + Intronic
943126894 2:183804828-183804850 CAATGTTAATAGATAAATTTGGG - Intergenic
943631740 2:190261377-190261399 CAAAGTTAATTGAAAGAGGTGGG - Intronic
944121393 2:196244372-196244394 GAAATTTAATTTGTAAATGTTGG - Intronic
944784115 2:203050651-203050673 CAGACCTAATTTATAAATGTGGG - Intronic
945414115 2:209549417-209549439 AACACTTAATTGATTAATGGAGG - Intronic
945523256 2:210855803-210855825 CAAAATTAATTAGAAAATGTAGG + Intergenic
945575097 2:211520930-211520952 TGAACTTAATGGATAAATGTAGG + Intronic
945581239 2:211597505-211597527 AAAATTTACTTGATAAATTTTGG - Intronic
945633224 2:212311142-212311164 CAAATTCATTTAATAAATGTTGG - Intronic
946666443 2:222054521-222054543 CACAATTATCTGATAAATGTAGG - Intergenic
948885664 2:240882387-240882409 CAAATTTAATTGATAAATAAAGG - Intergenic
1169665593 20:8032294-8032316 CAGACTTAACTGATATTTGTAGG - Intergenic
1169744560 20:8930253-8930275 TAAACTTAGTTGATAAAGGCAGG - Intronic
1169744640 20:8931228-8931250 CAAACTTAATTGATAAATGTTGG - Intronic
1170142198 20:13136081-13136103 TAAACTTAAATGATAAATTTAGG + Intronic
1170350212 20:15432319-15432341 CAAAATAAAATGAGAAATGTAGG + Intronic
1170531584 20:17298234-17298256 CAATTTTAATTGATAGAGGTGGG + Intronic
1171205323 20:23274607-23274629 TATATTTAATTTATAAATGTGGG + Intergenic
1173502013 20:43560772-43560794 ATAAATGAATTGATAAATGTTGG - Intronic
1173885546 20:46455043-46455065 TAAACTAAATTAATAAATGTTGG - Intergenic
1176850811 21:13911687-13911709 TAAATTTAATTAATAAATTTTGG + Intergenic
1176951782 21:15056126-15056148 CTAACTTGTTTGATAAATGGGGG + Intronic
1177595774 21:23240464-23240486 CAAACTTATATGATAAACTTTGG + Intergenic
1177858656 21:26427213-26427235 CAAACTTCATAGATTAATGGGGG + Intergenic
1178505940 21:33163055-33163077 CAAAGTTAATTCATACCTGTCGG - Intergenic
1179419513 21:41224152-41224174 CAAAATTATTTTATAATTGTTGG + Intronic
1180046064 21:45306162-45306184 TATACTTAATTAATAAATGGGGG - Intergenic
1181547916 22:23614063-23614085 CAAAATTAATTGAGAAATAAAGG + Intronic
1181944182 22:26502947-26502969 AAGAGTTATTTGATAAATGTGGG - Intronic
1184873155 22:47254153-47254175 CAATCAGATTTGATAAATGTTGG + Intergenic
949180956 3:1130894-1130916 CCATCTTAATTTATAAATGATGG - Intronic
949441526 3:4086294-4086316 GAAACTAAAATAATAAATGTGGG - Intronic
951969448 3:28427758-28427780 CACACTTAAGTCATAAAAGTGGG - Intronic
952806340 3:37357016-37357038 CAAATCGAATTGGTAAATGTAGG + Intronic
953300016 3:41764579-41764601 AAAACTTAAAAGAGAAATGTAGG + Intronic
953445713 3:42963923-42963945 CAAAGTTACTCAATAAATGTTGG + Intronic
954176044 3:48846842-48846864 CAAACGCAACTGTTAAATGTAGG + Intronic
957318816 3:78602979-78603001 CAAACTTACTTGTTGTATGTTGG - Intronic
957810667 3:85217532-85217554 CAGATTTAATACATAAATGTAGG - Intronic
957984881 3:87561549-87561571 CAAACTTAATTAAAAAATATGGG + Intergenic
959307304 3:104684501-104684523 ACAACTTAATTGATAAAAATTGG - Intergenic
959368464 3:105492608-105492630 CAAAATTATTTGACATATGTTGG - Intronic
959821426 3:110739755-110739777 AAAAGTCAATTGATAAATGATGG + Intergenic
960295502 3:115938378-115938400 GAAACTAAATGGTTAAATGTTGG - Intronic
961183431 3:124894433-124894455 CCAACTTAATTGAAAAATGCTGG - Intronic
961522684 3:127476231-127476253 TAGACTAAATAGATAAATGTGGG - Intergenic
962246761 3:133801913-133801935 CATTTTTAATTGATAAAGGTAGG - Intronic
962332457 3:134490218-134490240 GAAATTTAAATGTTAAATGTTGG - Intronic
965658269 3:171013889-171013911 GAAACTCAAGTGATAAATGGGGG + Intronic
965970360 3:174547093-174547115 CAAACTTAATTTTATAATGTGGG + Intronic
966161260 3:176970962-176970984 AAAACTTTATTTATAAATATAGG - Intergenic
966552463 3:181220419-181220441 CAAAGTTAATTGTTTCATGTAGG + Intergenic
966671640 3:182533444-182533466 CATACTTAATGGTGAAATGTTGG + Intergenic
967476022 3:189920590-189920612 TCAACTTATTTGATAGATGTAGG - Intergenic
968766257 4:2471350-2471372 TGAACTTAATTGGTAAAAGTTGG + Intronic
970412297 4:15820089-15820111 CAAACTAAGTTCATAAATGAAGG + Intronic
970517717 4:16850001-16850023 CAAAGTTTATTAATATATGTTGG - Intronic
970771611 4:19619536-19619558 CATACTTAATTGGCAAAAGTTGG + Intergenic
971065870 4:23032576-23032598 TAAAATAAAATGATAAATGTAGG + Intergenic
971594021 4:28505113-28505135 CAAAAGTATTTGATAAATTTTGG - Intergenic
971732343 4:30401203-30401225 TAAACTTAACAGATTAATGTAGG + Intergenic
971818134 4:31516559-31516581 CAAATTTCAGTGATAAAGGTTGG - Intergenic
972552274 4:40145119-40145141 TAAACTTAATTGATATTTCTTGG + Intronic
972940631 4:44190876-44190898 CAAATTTATCTTATAAATGTAGG + Intronic
973255381 4:48106949-48106971 TAAACTAAACTTATAAATGTGGG - Intronic
973370167 4:49239215-49239237 TAAATTTAATTAATAAATTTTGG + Intergenic
973390861 4:49556197-49556219 TAAATTTAATTAATAAATTTTGG - Intergenic
974362843 4:60904624-60904646 CAAACTGCCTTGAAAAATGTAGG - Intergenic
974522419 4:63000260-63000282 AAAAGATAAATGATAAATGTTGG + Intergenic
974698813 4:65410881-65410903 CAAATGTGATTGATAAATCTTGG + Intronic
974960794 4:68697688-68697710 TAAACTTAACTGATAAGTGCTGG + Intergenic
975079516 4:70259381-70259403 AAAAATTAATTGATAAAAATAGG - Intergenic
976369852 4:84275093-84275115 CAAAATGACTTGATAAATTTGGG + Intergenic
976992892 4:91390747-91390769 TCAACTTCTTTGATAAATGTAGG + Intronic
977441214 4:97070404-97070426 CAGACTTAAAGGATGAATGTGGG - Intergenic
979870690 4:125816595-125816617 CAAACTTAGATGATAAAAGAAGG + Intergenic
981623361 4:146729255-146729277 GAAACGTAAATGAAAAATGTAGG - Intronic
983097330 4:163579204-163579226 CATAATTATTTGATACATGTTGG + Intronic
988174957 5:27710901-27710923 CAAACTTAATTGATAAATGTTGG + Intergenic
988370015 5:30356526-30356548 CCAACATCATTGAGAAATGTAGG - Intergenic
988425657 5:31060464-31060486 CAAACTAAATGGATAAGTGATGG - Intergenic
988491372 5:31708240-31708262 CAATTTTAATTTATAATTGTGGG - Intronic
988903342 5:35758131-35758153 CATAATTGTTTGATAAATGTAGG + Intronic
992278752 5:75151021-75151043 AAAACTTCATTGATAATTGAAGG - Intronic
993411061 5:87573740-87573762 CAAGTATAATTGATAAATTTGGG - Intergenic
993901506 5:93587215-93587237 CAAACATTATTGAAAAAAGTAGG - Intronic
993922212 5:93819442-93819464 CAAACTTACTTTAAAAATCTAGG - Intronic
994755918 5:103792814-103792836 CAAAGTAAATTGATTGATGTTGG + Intergenic
995102766 5:108334520-108334542 GAAACTGAATTGAAAATTGTGGG - Intronic
995576269 5:113538447-113538469 CTAACTTACTTGAAAAATGGTGG - Intronic
996165901 5:120223109-120223131 AAAACTCAATTGATAAAATTAGG - Intergenic
998283202 5:140832699-140832721 CAAATTTAATAGATAAATAAAGG + Intronic
1000829457 5:166084992-166085014 CACACTAACTTGCTAAATGTAGG + Intergenic
1001459185 5:171894349-171894371 GAAACTTATTTGAGAAAAGTAGG - Intronic
1003762503 6:9196178-9196200 CAACTTCAATTTATAAATGTTGG - Intergenic
1003788026 6:9509622-9509644 TAAAATTAAGTTATAAATGTAGG + Intergenic
1006041730 6:31261665-31261687 CAGACTTAATTCATTAATGGGGG - Intergenic
1008002495 6:46375333-46375355 CAAGCATAAGTGATAAATGTGGG - Intronic
1008043800 6:46831354-46831376 CAAACTTACATGAAAAATGTTGG + Intronic
1008871984 6:56283418-56283440 CAAACTTAACAAATAAATTTAGG + Intronic
1009482629 6:64178852-64178874 CAAACTTGGTTTATAAATTTAGG - Intronic
1010064799 6:71669768-71669790 TGAACTTAATTGCTAAATGTTGG + Intergenic
1010367125 6:75064018-75064040 CAAACATAATTGATAAAAGCTGG + Intergenic
1011891249 6:92163300-92163322 CAAAAGTAATTGAAAATTGTTGG + Intergenic
1012875233 6:104718716-104718738 CAAACCTAATTCATCATTGTTGG + Intergenic
1013161789 6:107552282-107552304 CATACTTAAATTATAAATGGAGG - Intronic
1013823754 6:114186020-114186042 AGAACTTAATCAATAAATGTTGG + Intronic
1014652811 6:124062157-124062179 TAAACTTAATTGAAAAAAATAGG - Intronic
1014673871 6:124340769-124340791 ATAACTTAATTTATAATTGTAGG + Intronic
1017029064 6:150205065-150205087 TAAAATGAATTGCTAAATGTAGG + Intronic
1017353815 6:153478219-153478241 CAAAAAGAATTGATAGATGTTGG + Intergenic
1018337173 6:162805655-162805677 TAAACTTAATTGATAAAGCATGG - Intronic
1019042967 6:169121368-169121390 CAAACTTAAGTTATCAATGACGG - Intergenic
1019692468 7:2424051-2424073 CAAAATTAATTGATTAATTAAGG + Intronic
1020808009 7:12814645-12814667 CTAACATAATTGGTAAATATAGG - Intergenic
1020980013 7:15054969-15054991 TAAACTTAATTTATAAAATTAGG + Intergenic
1021200869 7:17727357-17727379 CTAAATTAATTGCTATATGTAGG - Intergenic
1022159993 7:27700769-27700791 CAGGCTTAAATAATAAATGTGGG - Intergenic
1022713609 7:32876513-32876535 AAAATGTAAGTGATAAATGTAGG + Intronic
1023514801 7:40991284-40991306 CAAATCTGATTAATAAATGTTGG - Intergenic
1023647504 7:42333615-42333637 CAAACTTCACAGAGAAATGTAGG + Intergenic
1023658004 7:42445931-42445953 CAAACCAAATTGAGAAATATGGG - Intergenic
1024445044 7:49467476-49467498 CATTCTAAATTGATAAGTGTGGG - Intergenic
1024600746 7:50978770-50978792 AAAACTTTATTGACAAATGCAGG - Intergenic
1024709780 7:52002581-52002603 CAAACTTTATTTAAAAATTTGGG + Intergenic
1024862325 7:53859492-53859514 CAAACTCATTTGATCTATGTTGG + Intergenic
1025214733 7:57046592-57046614 CCAAGTTAATTTATAAAAGTTGG - Intergenic
1025657220 7:63530218-63530240 CCAAGTTAATTTATAAAAGTTGG + Intergenic
1026346728 7:69480897-69480919 CAAACCTAATGTATAAATTTTGG - Intergenic
1027530207 7:79321827-79321849 GTAACTTAAATGAGAAATGTAGG - Intronic
1027575466 7:79924969-79924991 CAGACTTTACTGAAAAATGTTGG - Intergenic
1027909656 7:84233719-84233741 CAAACTGAATTGAAAACAGTAGG - Intronic
1027917652 7:84346623-84346645 CAAAGTTAATAGATAAATGTTGG - Intronic
1028739455 7:94256560-94256582 TAAACAAAATTAATAAATGTTGG + Intergenic
1029684468 7:102136695-102136717 CCAAGTTAATTTATAAAAGTTGG - Intronic
1030930082 7:115511982-115512004 CAAACTTAAGAAATTAATGTTGG - Intergenic
1031469066 7:122147418-122147440 AAAACTTAATTTACAAAAGTAGG + Intergenic
1036011472 8:4730371-4730393 CAAACTAAATTTGTAAATATGGG + Intronic
1036031746 8:4981557-4981579 CAAACATAAATAATAAATGTAGG - Intronic
1036045367 8:5134166-5134188 CAAACACAGTTGGTAAATGTGGG + Intergenic
1036909913 8:12748641-12748663 CAAACTTAATGAAGAAATGGAGG - Intronic
1038856628 8:31340145-31340167 CAAATTTCATTGACTAATGTAGG - Intergenic
1040101218 8:43508032-43508054 TAAATTTAATTAATAAATTTTGG - Intergenic
1041243947 8:55873433-55873455 CAAACTAAATTCAGAAATGCTGG - Intergenic
1041623077 8:59996081-59996103 TTAAATAAATTGATAAATGTAGG + Intergenic
1042218715 8:66452486-66452508 TAAACTTAAGACATAAATGTGGG + Intronic
1044170525 8:89045880-89045902 TTGACTTAATTGATAAATTTGGG + Intergenic
1045073581 8:98537931-98537953 GAAACTTAATGAATAATTGTGGG - Intronic
1045100536 8:98839484-98839506 GCAACTTAATGAATAAATGTTGG - Intronic
1046481842 8:114830620-114830642 CAAATTTGATTATTAAATGTAGG - Intergenic
1046959930 8:120100710-120100732 CAAACTAAATTGATAAGTGAAGG - Intronic
1047090106 8:121565203-121565225 CAAAGTTAAAAGATAAATTTTGG + Intergenic
1048500844 8:134973774-134973796 CAAACTGCATGGATAAAGGTTGG + Intergenic
1048902462 8:139051892-139051914 CAAACTTAATCAGTAAGTGTTGG + Intergenic
1050947035 9:11536981-11537003 AAATATTAATTGATAAATCTAGG + Intergenic
1051509033 9:17857150-17857172 TTAAAGTAATTGATAAATGTGGG - Intergenic
1051522514 9:18005172-18005194 CACACTTAAATGATAACTGAAGG + Intergenic
1051972418 9:22906016-22906038 CAAACAAAGATGATAAATGTTGG - Intergenic
1052715264 9:32108560-32108582 CAAAATTAAATGAAAAATATAGG - Intergenic
1053225048 9:36347588-36347610 AAAACTTAATTGATAAATGTTGG + Intronic
1055300081 9:74873636-74873658 TATTCTTAATTGATAATTGTTGG - Intronic
1055590481 9:77807944-77807966 CAAACTTTATTTATAAAAATAGG + Intronic
1055758296 9:79578745-79578767 CAAACATAATTGTTAAAAATTGG - Intronic
1056287243 9:85102351-85102373 CAAACTTAAATGTAAAATCTGGG - Intergenic
1056587082 9:87935187-87935209 TAAATTTAATTAATAAATTTTGG + Intergenic
1056609789 9:88117750-88117772 TAAATTTAATTAATAAATTTTGG - Intergenic
1057162560 9:92899579-92899601 TAAATTTAATTAATAAATTTTGG + Intergenic
1057977197 9:99618901-99618923 AAAACTTAATCTATATATGTTGG - Intergenic
1058920098 9:109605621-109605643 TGAACTTAATAGACAAATGTTGG + Intergenic
1058977718 9:110140127-110140149 CAAACTTCATTTATTTATGTCGG + Intronic
1059854418 9:118380222-118380244 GAAATTTAATAGATTAATGTTGG - Intergenic
1060413477 9:123415041-123415063 GCAACTGAATTGATAAATGGTGG + Intronic
1186936502 X:14456334-14456356 CACAAAGAATTGATAAATGTTGG - Intergenic
1190680690 X:52825747-52825769 TAAATTTAATTAATAAATTTTGG - Intergenic
1191743444 X:64461236-64461258 AAAACTTACTTTATAAATCTGGG + Intergenic
1191747322 X:64503356-64503378 AAAACTTACTTTATAAATCTAGG - Intergenic
1191813312 X:65215967-65215989 CAAACTTAATCATTAATTGTTGG - Intergenic
1192334542 X:70206300-70206322 CAAAATTAGTTCATAAGTGTGGG + Intergenic
1193283833 X:79688269-79688291 CAAAATTAATAAATAAATATAGG + Intergenic
1193939871 X:87669034-87669056 CAAACTTAATTGGGAAAAGGAGG + Intronic
1194167864 X:90542850-90542872 CAAACTTAATTGATAAATATAGG - Intergenic
1194183960 X:90748645-90748667 GAAACTAACTTGATAAATGAAGG - Intergenic
1194591226 X:95802318-95802340 CAAACTTAATCAGTAAATGCTGG + Intergenic
1194759805 X:97782474-97782496 AAAACTTAATCGATAAATGTGGG + Intergenic
1194933680 X:99920411-99920433 CAAACCTACCTGATAAATGATGG - Intergenic
1196014425 X:110922476-110922498 TAAAATTAATTGATGAATGATGG + Intergenic
1196470927 X:116025825-116025847 CTCACCAAATTGATAAATGTAGG - Intergenic
1196553187 X:117055105-117055127 CAAAATGTAATGATAAATGTTGG + Intergenic
1198478837 X:137022279-137022301 CAAATTGTATTGATAAATATGGG + Intergenic
1198858112 X:141039938-141039960 CATAAATAAATGATAAATGTTGG + Intergenic
1198904583 X:141547432-141547454 CATAAATAAATGATAAATGTTGG - Intergenic
1199119627 X:144036204-144036226 CAACCTTAATTGAGAACTGCAGG + Intergenic
1199296399 X:146163646-146163668 CAAACTTACTAGATAAAAGATGG - Intergenic
1199392018 X:147291102-147291124 TAAACTTAATAGAATAATGTAGG - Intergenic
1199534999 X:148892640-148892662 CAAACTTAAAATATAAATGCGGG - Intronic
1199621962 X:149709856-149709878 TATACTTAATTGTAAAATGTTGG + Intronic
1199892699 X:152102555-152102577 GAAATTCAATTGAGAAATGTTGG + Intergenic
1200514121 Y:4120640-4120662 CAAACTTAATTGATAAATATAGG - Intergenic
1200530553 Y:4330576-4330598 GAAACTAACTTGATAAATGAAGG - Intergenic
1201371947 Y:13275083-13275105 AAAACTTAACTGATAAAAGCAGG + Intronic
1201508724 Y:14734056-14734078 CAAATTGAAATGGTAAATGTGGG + Intronic