ID: 988175705

View in Genome Browser
Species Human (GRCh38)
Location 5:27721992-27722014
Sequence CTGTGTAAGAACAACTATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988175705_988175708 12 Left 988175705 5:27721992-27722014 CCCAAATAGTTGTTCTTACACAG No data
Right 988175708 5:27722027-27722049 ACACAGCCAGTTCTTCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988175705 Original CRISPR CTGTGTAAGAACAACTATTT GGG (reversed) Intergenic
No off target data available for this crispr