ID: 988183440

View in Genome Browser
Species Human (GRCh38)
Location 5:27828551-27828573
Sequence GGCAAAGCTGCATTCCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988183440_988183441 -8 Left 988183440 5:27828551-27828573 CCAGCAAGGAATGCAGCTTTGCC No data
Right 988183441 5:27828566-27828588 GCTTTGCCAACACTGATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988183440 Original CRISPR GGCAAAGCTGCATTCCTTGC TGG (reversed) Intergenic
No off target data available for this crispr