ID: 988185746

View in Genome Browser
Species Human (GRCh38)
Location 5:27859359-27859381
Sequence AAGAGAAAATAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988185741_988185746 30 Left 988185741 5:27859306-27859328 CCTATTATTAACAAAGCTCATTT No data
Right 988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988185746 Original CRISPR AAGAGAAAATAGAAGGAGGA AGG Intergenic
No off target data available for this crispr