ID: 988185901

View in Genome Browser
Species Human (GRCh38)
Location 5:27861612-27861634
Sequence GTGTGTGCATGAAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988185901_988185908 20 Left 988185901 5:27861612-27861634 CCCCCTTCCCTTCATGCACACAC No data
Right 988185908 5:27861655-27861677 AATTTGACATTCACCGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988185901 Original CRISPR GTGTGTGCATGAAGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr