ID: 988191161

View in Genome Browser
Species Human (GRCh38)
Location 5:27936874-27936896
Sequence GGCTAGAGACTATCCTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988191157_988191161 -4 Left 988191157 5:27936855-27936877 CCTGTGTCACTGAGTCATTGGCT No data
Right 988191161 5:27936874-27936896 GGCTAGAGACTATCCTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988191161 Original CRISPR GGCTAGAGACTATCCTGGGA GGG Intergenic
No off target data available for this crispr