ID: 988192513

View in Genome Browser
Species Human (GRCh38)
Location 5:27957708-27957730
Sequence GATTCGGAAAAATAACTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988192513_988192524 11 Left 988192513 5:27957708-27957730 CCCATTAGTTATTTTTCCGAATC No data
Right 988192524 5:27957742-27957764 CCCATACTCCACCCTCAGGTGGG No data
988192513_988192529 27 Left 988192513 5:27957708-27957730 CCCATTAGTTATTTTTCCGAATC No data
Right 988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG No data
988192513_988192518 7 Left 988192513 5:27957708-27957730 CCCATTAGTTATTTTTCCGAATC No data
Right 988192518 5:27957738-27957760 TCCCCCCATACTCCACCCTCAGG No data
988192513_988192522 10 Left 988192513 5:27957708-27957730 CCCATTAGTTATTTTTCCGAATC No data
Right 988192522 5:27957741-27957763 CCCCATACTCCACCCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988192513 Original CRISPR GATTCGGAAAAATAACTAAT GGG (reversed) Intergenic
No off target data available for this crispr