ID: 988192514

View in Genome Browser
Species Human (GRCh38)
Location 5:27957709-27957731
Sequence TGATTCGGAAAAATAACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988192514_988192522 9 Left 988192514 5:27957709-27957731 CCATTAGTTATTTTTCCGAATCA No data
Right 988192522 5:27957741-27957763 CCCCATACTCCACCCTCAGGTGG No data
988192514_988192524 10 Left 988192514 5:27957709-27957731 CCATTAGTTATTTTTCCGAATCA No data
Right 988192524 5:27957742-27957764 CCCATACTCCACCCTCAGGTGGG No data
988192514_988192518 6 Left 988192514 5:27957709-27957731 CCATTAGTTATTTTTCCGAATCA No data
Right 988192518 5:27957738-27957760 TCCCCCCATACTCCACCCTCAGG No data
988192514_988192529 26 Left 988192514 5:27957709-27957731 CCATTAGTTATTTTTCCGAATCA No data
Right 988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988192514 Original CRISPR TGATTCGGAAAAATAACTAA TGG (reversed) Intergenic
No off target data available for this crispr