ID: 988192520

View in Genome Browser
Species Human (GRCh38)
Location 5:27957740-27957762
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988192520_988192529 -5 Left 988192520 5:27957740-27957762 CCCCCATACTCCACCCTCAGGTG No data
Right 988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988192520 Original CRISPR CACCTGAGGGTGGAGTATGG GGG (reversed) Intergenic
No off target data available for this crispr