ID: 988192525 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:27957743-27957765 |
| Sequence | GCCCACCTGAGGGTGGAGTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 988192525_988192529 | -8 | Left | 988192525 | 5:27957743-27957765 | CCATACTCCACCCTCAGGTGGGC | No data | ||
| Right | 988192529 | 5:27957758-27957780 | AGGTGGGCCCCAGTGTGTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 988192525 | Original CRISPR | GCCCACCTGAGGGTGGAGTA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||