ID: 988192529

View in Genome Browser
Species Human (GRCh38)
Location 5:27957758-27957780
Sequence AGGTGGGCCCCAGTGTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988192516_988192529 0 Left 988192516 5:27957735-27957757 CCCTCCCCCCATACTCCACCCTC No data
Right 988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG No data
988192517_988192529 -1 Left 988192517 5:27957736-27957758 CCTCCCCCCATACTCCACCCTCA No data
Right 988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG No data
988192521_988192529 -6 Left 988192521 5:27957741-27957763 CCCCATACTCCACCCTCAGGTGG No data
Right 988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG No data
988192514_988192529 26 Left 988192514 5:27957709-27957731 CCATTAGTTATTTTTCCGAATCA No data
Right 988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG No data
988192519_988192529 -4 Left 988192519 5:27957739-27957761 CCCCCCATACTCCACCCTCAGGT No data
Right 988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG No data
988192513_988192529 27 Left 988192513 5:27957708-27957730 CCCATTAGTTATTTTTCCGAATC No data
Right 988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG No data
988192523_988192529 -7 Left 988192523 5:27957742-27957764 CCCATACTCCACCCTCAGGTGGG No data
Right 988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG No data
988192525_988192529 -8 Left 988192525 5:27957743-27957765 CCATACTCCACCCTCAGGTGGGC No data
Right 988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG No data
988192520_988192529 -5 Left 988192520 5:27957740-27957762 CCCCCATACTCCACCCTCAGGTG No data
Right 988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG No data
988192515_988192529 11 Left 988192515 5:27957724-27957746 CCGAATCATCTCCCTCCCCCCAT No data
Right 988192529 5:27957758-27957780 AGGTGGGCCCCAGTGTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988192529 Original CRISPR AGGTGGGCCCCAGTGTGTAC TGG Intergenic
No off target data available for this crispr