ID: 988205975

View in Genome Browser
Species Human (GRCh38)
Location 5:28135064-28135086
Sequence TATCCTACTTCTAAGGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988205975_988205982 1 Left 988205975 5:28135064-28135086 CCTACCCCCTTAGAAGTAGGATA No data
Right 988205982 5:28135088-28135110 ATAGGTGTATGTACCCCATTGGG No data
988205975_988205984 9 Left 988205975 5:28135064-28135086 CCTACCCCCTTAGAAGTAGGATA No data
Right 988205984 5:28135096-28135118 ATGTACCCCATTGGGATATTGGG No data
988205975_988205983 8 Left 988205975 5:28135064-28135086 CCTACCCCCTTAGAAGTAGGATA No data
Right 988205983 5:28135095-28135117 TATGTACCCCATTGGGATATTGG No data
988205975_988205981 0 Left 988205975 5:28135064-28135086 CCTACCCCCTTAGAAGTAGGATA No data
Right 988205981 5:28135087-28135109 TATAGGTGTATGTACCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988205975 Original CRISPR TATCCTACTTCTAAGGGGGT AGG (reversed) Intergenic
No off target data available for this crispr