ID: 988206928

View in Genome Browser
Species Human (GRCh38)
Location 5:28149702-28149724
Sequence ATCTTCTACTTGGAGAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988206928_988206934 14 Left 988206928 5:28149702-28149724 CCATAGTTCTCCAAGTAGAAGAT No data
Right 988206934 5:28149739-28149761 TCATGTGGATATTGAGCTCATGG No data
988206928_988206930 -1 Left 988206928 5:28149702-28149724 CCATAGTTCTCCAAGTAGAAGAT No data
Right 988206930 5:28149724-28149746 TGCTGCCCATAGACCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988206928 Original CRISPR ATCTTCTACTTGGAGAACTA TGG (reversed) Intergenic
No off target data available for this crispr