ID: 988208949

View in Genome Browser
Species Human (GRCh38)
Location 5:28177614-28177636
Sequence TGGGAGAGGCATGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988208949_988208960 6 Left 988208949 5:28177614-28177636 CCCTCCTCCTCATGCCTCTCCCA No data
Right 988208960 5:28177643-28177665 CAGGCCTCCTGGAGCAGGTGTGG No data
988208949_988208963 27 Left 988208949 5:28177614-28177636 CCCTCCTCCTCATGCCTCTCCCA No data
Right 988208963 5:28177664-28177686 GGCTGTAGCCCAGCAGATAGTGG No data
988208949_988208959 1 Left 988208949 5:28177614-28177636 CCCTCCTCCTCATGCCTCTCCCA No data
Right 988208959 5:28177638-28177660 TAGGTCAGGCCTCCTGGAGCAGG No data
988208949_988208956 -5 Left 988208949 5:28177614-28177636 CCCTCCTCCTCATGCCTCTCCCA No data
Right 988208956 5:28177632-28177654 TCCCACTAGGTCAGGCCTCCTGG No data
988208949_988208964 30 Left 988208949 5:28177614-28177636 CCCTCCTCCTCATGCCTCTCCCA No data
Right 988208964 5:28177667-28177689 TGTAGCCCAGCAGATAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988208949 Original CRISPR TGGGAGAGGCATGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr