ID: 988210069

View in Genome Browser
Species Human (GRCh38)
Location 5:28192588-28192610
Sequence GTTCCCATGGGATCTCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988210069_988210072 -8 Left 988210069 5:28192588-28192610 CCAGCTTGAGATCCCATGGGAAC No data
Right 988210072 5:28192603-28192625 ATGGGAACAACCATAATTGTAGG No data
988210069_988210075 7 Left 988210069 5:28192588-28192610 CCAGCTTGAGATCCCATGGGAAC No data
Right 988210075 5:28192618-28192640 ATTGTAGGCCAAGACATATAGGG No data
988210069_988210074 6 Left 988210069 5:28192588-28192610 CCAGCTTGAGATCCCATGGGAAC No data
Right 988210074 5:28192617-28192639 AATTGTAGGCCAAGACATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988210069 Original CRISPR GTTCCCATGGGATCTCAAGC TGG (reversed) Intergenic
No off target data available for this crispr