ID: 988211478

View in Genome Browser
Species Human (GRCh38)
Location 5:28210178-28210200
Sequence CTGTTGTTATGAAGGACAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988211478_988211486 10 Left 988211478 5:28210178-28210200 CCCGTTGTCCTTCATAACAACAG No data
Right 988211486 5:28210211-28210233 CATAGGAAAACATGTTATGTGGG No data
988211478_988211485 9 Left 988211478 5:28210178-28210200 CCCGTTGTCCTTCATAACAACAG No data
Right 988211485 5:28210210-28210232 CCATAGGAAAACATGTTATGTGG No data
988211478_988211483 -7 Left 988211478 5:28210178-28210200 CCCGTTGTCCTTCATAACAACAG No data
Right 988211483 5:28210194-28210216 ACAACAGGGAATTTTTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988211478 Original CRISPR CTGTTGTTATGAAGGACAAC GGG (reversed) Intergenic
No off target data available for this crispr