ID: 988214408

View in Genome Browser
Species Human (GRCh38)
Location 5:28252651-28252673
Sequence ATAGATAATTAGACAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988214408_988214412 -8 Left 988214408 5:28252651-28252673 CCCTGCCCTGTCTAATTATCTAT No data
Right 988214412 5:28252666-28252688 TTATCTATTTGTTCTGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988214408 Original CRISPR ATAGATAATTAGACAGGGCA GGG (reversed) Intergenic
No off target data available for this crispr