ID: 988218937

View in Genome Browser
Species Human (GRCh38)
Location 5:28316524-28316546
Sequence CTGTGGGCCTCTCTAGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988218937_988218941 3 Left 988218937 5:28316524-28316546 CCCAAATCTAGAGAGGCCCACAG No data
Right 988218941 5:28316550-28316572 GTTACAACGTTTCTTAATAGTGG No data
988218937_988218942 4 Left 988218937 5:28316524-28316546 CCCAAATCTAGAGAGGCCCACAG No data
Right 988218942 5:28316551-28316573 TTACAACGTTTCTTAATAGTGGG No data
988218937_988218945 9 Left 988218937 5:28316524-28316546 CCCAAATCTAGAGAGGCCCACAG No data
Right 988218945 5:28316556-28316578 ACGTTTCTTAATAGTGGGAGGGG No data
988218937_988218943 7 Left 988218937 5:28316524-28316546 CCCAAATCTAGAGAGGCCCACAG No data
Right 988218943 5:28316554-28316576 CAACGTTTCTTAATAGTGGGAGG No data
988218937_988218944 8 Left 988218937 5:28316524-28316546 CCCAAATCTAGAGAGGCCCACAG No data
Right 988218944 5:28316555-28316577 AACGTTTCTTAATAGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988218937 Original CRISPR CTGTGGGCCTCTCTAGATTT GGG (reversed) Intergenic
No off target data available for this crispr